А. CELLULAR STRUCTURE AND BIOMOLECULE 1 & 2. Give two unique properties of the organelles emphasized by the endosymbiotic theory.
Q: 6. How would an increase in blood pressure affect the delivery of nutrients to body cells?
A: The blood is the medium that exchanges gases and nutrients with the cells. Blood flows through…
Q: 5. Discuss the nucleus and explain its immense functions.
A:
Q: 15. Describe 4 functions of cytoskeletal proteins. А.
A: Cytoskeleton is the network of fiber forming "infrastructure" of eukaryotic , prokaryotic . It is…
Q: 1.Describe the metabolic pathways utilized by the red cell.
A: RBCs cannot depend on aerobic glycolysis, as in the Krebs's cycle, fr extraction of energy from…
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: 25. Which of the following best defines cell theory? A) It is the scientific theory that states that…
A: All living organisms are formed from cells. This was laid out in Cell theory given by 3 scientists,…
Q: 6. What other type of cell death exists? Give its definition. 7. Give a splashful characterization…
A: Types of cell death : 1. Apoptosis 2. Autophagy 3. Necrosis
Q: B- Remember the main function of the following for 3.only: 1- Checkpoint during cell division 2-…
A: Introduction :- A checkpoint is a stage in the eukaryotic cell cycle where the cell considers…
Q: 11. Phagocytosis, pinocytosis, and receptor-mediated endocytosis all involve C the export of…
A: Introduction :- Pinocytosis is the process of live cells ingesting liquid droplets. Endocytosis is…
Q: b. How is the DNA information used to make proteins for ongoing cellular processes and cellular…
A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…
Q: 1: What material(s) is/are transported by the cells within the red oval?
A: Vascular plants are the most dominant type of land/terrestrial plants as they transport both water…
Q: 1. Recognize the structures in figure that represent ADP. * O A. A and B O B. A, B and C O C. A, B…
A: The nucleotides are the basic unit of nucleic acids, that means they are the basic unit of DNA and…
Q: What cell type contributes to the formation of a foreign body giant cell? Draw the cell(s) before…
A: Introduction: A macrophage is a type of white blood cell (WBC) present within the immune system of…
Q: Differntiate between cytotaxonomy and chemotaxonomy?
A: Scientific classification is the study of naming, depicting, and grouping creatures and incorporates…
Q: Why do tissues swell during inflammation? Tissues swell during inflammation because of the volume of…
A: Inflammation is a sort of immunological response that creates during the time of injury or invasion…
Q: II. CELL FEATURE OBSERVATION The following questions pertains to the features of cells. Provide the…
A: Cell is the structural and functional unit of all the individual both unicellular as well as…
Q: 10. (a) How are malignant neoplastic cells/ tissues different from normal cells/ apoptosis tissues?…
A: Introduction: Neoplastic cells are the cells which abnormally forms a mass of tissue and do not die…
Q: 3. (a) What are the different methods of cell lysis? Discuss in detail.
A: Cell disruption refers to the process of breaking cells in order to obtain the desired product,…
Q: b. Individuals with these cancers may be treated with one of the following chemotherapeutic drugs.…
A: Cancer is a complex disease in which different molecules are involved in the development of this…
Q: 17.List the cytoskeleton in the order to increasing size Name of the Protein it is cytoskeleton made…
A: The cytoskeleton is a structure that helps cells maintain their shape and internal organization, and…
Q: b. Individuals with these cancers may be treated with one of the following chemotherapeutic drugs.…
A: In cancer the uncontrolled cell division and growth occurs that it leads to the uncontrol cell…
Q: Explain the concept map depicted below. Explain how etiological agents/lifestyle/environment can…
A: Necrosis : It is the death of the body tissue . It occurs when too little blood flows through the…
Q: What is the role of epithelial-mesenchymal transition” (EMT) and MET in metastasis?
A: Epithelial mesenchymal change (EMT), a developmentally conserved formative program, has been…
Q: 9. What is cellular regeneration? How is mitosis related to this process?
A: The ability of cells to develop into the same form after an injury is called cellular regeneration.…
Q: 2- When a liver is partially resecieu occur cellular adaptation by -hyperplasia. 3- The mitochondria…
A: Introduction The mitochondrion is a double membrane-bound organelle found in most eukaryotic…
Q: 25) Identify the most correct choice: Oa) ribosomes are the membrane bound organelles responsible…
A: Introduction :- Gene therapy is the process of changing the genes in your body's cells in order to…
Q: 2. Why is it so challenging to distinguish between cells in G1 and G2 using standard microscopy…
A: Note- As per Bartleby guidelines experts are only allowed to answer one question at a time, kindly…
Q: 4. Write a short paragraph on mutations and how they may alter protein synthesis and function.
A: Introduction :- A mutation is a change in the genetic material in biology. This refers to changes in…
Q: Define cell. Name three basic cell features in all living organisms. (found both in prokaryotes and…
A: A cell is the basic membrane-bound unit that containing all the fundamental molecules of life. It is…
Q: 5) Briefly explain why the formation of a tumour can pose a risk to a person's homeostasis.
A: Cancer is a condition in which cells proliferate abnormally and infiltrate, erode, and kill healthy…
Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…
A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…
Q: 38. What are the principal tissue stains used in histology and describe where and what color each…
A: The correct option is A The hematoxylin stains cell nuclei blue, and eosin stains the extracellular…
Q: At operation for removal of a suspicious mass, the lead surgeon suggested that, the mass could be a…
A: 1. Given that, in an operation, the lead surgeon suggested that the suspicious mass could be a…
Q: Please identify the G2 phase, prophase, prometaphase, metaphase, anaphase, and telophase of the…
A: During cell division, various stages that a cell undergoes are : Interphase Prophase Metaphase…
Q: Q/Choose between parentheses 1-the cell cycle included three phases are........ *…
A: The nuclear shell, endoplasmic reticulum (ER), Golgi apparatus, vesicles and other organelles…
Q: 1. Explain the importance of gluconeogenesis. Where does it occur in the cell? Which type of tissue…
A: Gluconeogenesis is the synthesis of glucose from those compounds that are not carbohydrates.…
Q: (c) Discuss the process of replication of DNA.
A: When a cell divides, DNA replicates itself via the process of replication.
Q: Describe two cells with atypical cell walls. Why is this information so important to know,…
A: Some bacteria like mycoplasma ,ricketssia shows pleomorphism due to absence of cell wall. They are…
Q: B. 1. 2. 3. 4. 5. 6. 7. 9. Which part of the cell controls cell activities and transmits hereditary…
A: The term cell is derived from the Latin word cellulae which means empty room. If an organism is made…
Q: a) What is the role of the lysosome in degrading proteins? What are the enzymes that…
A: a) Lysosomes are single membrane-bound organelles present in animal cells. Lysosomes have acidic…
Q: 8. Describe the fluid mosaic model of a cell mem the cell membrane and the internal endomemb…
A: Q8. Fluid Mosaic Model: S.J. Singer and Garth L. Nicolson proposed the fluid mosaic concept in 1972…
Q: 26) The principal functions of the ECM are ; EXCEPT a) Mechanical support for cell anchorage b) Cell…
A: Hi! Thank you for your question. As the first question posted by you is not clearly explained, we…
Q: The Cytoskeleton. Use the topic and relate the topic for initiation progression and…
A: Cytoskeleton : it is unique to eukaryotic cells . It is a three dimensional structure that fills the…
Q: Details Please answer the following prompt: How can two cells with the exact same genome obtain…
A: Hundreds of various cell kinds, ranging from immune cells to skin cells to neurons, make up the…
Q: Describe the main types of large-scale structural changes inchromosomes, and explain their potential…
A: A mutation occurs when the nucleotide sequence of a gene or chromosome changes. It can be…
Q: 15.Continuously proliferating cells include all of the following except a . Brain cells. B.Skin…
A: Human body is made up of trillions of cells. Every part of the body is made of cells. Cells compose…
Q: What is the importance of understanding the structures and functions of molecules involved in the…
A: By knowing and understanding the basics about cancer and following the recommended guidelines for…
Q: 3. List and briefly describe the steps of phagocytosis. An outlined illustration will be fine.
A: Phagocytosis is a process of a cell. Phagocytosis is done when cell want to destroy something. It…
Step by step
Solved in 4 steps
- Endoplasmic reticulum (ER) is the site of all the following EXCEPT A) drug detoxification by means of mixed-function oxidases B) synthesis of proteins that are secreted from the cell C) N-linked glycosylation of newly formed polypeptides D)Ca2+ storage in muscle tissues E) hydrolytic activities carried out by acid hydrolases Option 6if you visualize the cytoskeleton of a cell that is expanding in one direction, you typically observed a strong orientation of the cytoskeleton. Please answer the following three questions. a. Would the cytoskeleton be oriented parallel or perpendicular to the direction of cell expansion? b. Would the cellulose fibers in the cell wall be parallel or perpendicular to the cytoskeleton? c. Explain why cytoskeleton, cellulose fibers, and direction of cell expansion have the relationship mentioned in a and b?Which of the following statements best describes the synthesis of secreted proteins? a.) Secreted proteins are typically synthesized in the smooth endoplasmic reticulum and carried to the Golgi apparatus in vesicles. b.) Secreted proteins are typically synthesized in the rough endoplasmic reticulum and carried to the Golgi apparatus in vesicles. c.) Secreted proteins are typically synthesized in the Golgi apparatus. d.) Secreted proteins are typically synthesized in the cytoplasm and diffuse to the Golgi apparatus.
- Which of these amino acids is NOT a common attachment point for sugars in glycoproteins? A) Gly b) Ser c) Thr d) Asn In I-cell disease defective proteins are mislabeled which should be delivered to which organelle? A) nucleus b) mitochondria c) rough endoplasmic reticulum d) lysosome A glycoprotein involved in red blood cell production is: a) hemagglutinin b) erythropoietin c) p-glycoprotein d) cytochrome cMembers of the mycoplasma genus of bacteria do not have a cell wall for protection, existing with only a simple cell membrane made up of fatty acids and phospholipids. They cannot however, synthesize their own fatty acids. How is this possible? A. They use host materials B. They use peptidoglycan from other bacteria C. They use anabolism as a way to create their outer membrane D. They use amino acids to build their membranesItem27 Item 27 Ribosomes that are attached to the RER are called "free ribosomes". Group startsTrue or False Item28 Item 28 The cytoskeleton has three separate components: microfilaments, intermediate filaments, and ______________. Fill in the blank Item29 Item 29 Catalase-containing peroxisomes are most abundant in ______ cells. Multiple Choice liver kidney pancreas thymus pituitary
- Some genetic diseases cause deficient activity of lysosomes. What would be the direct consequence of these diseases? a.Fewer macromolecules within the cytosol. b.Less degradation of old organelles. c.Increased hydrolysis of macromolecules. d.Reduce rate of endocytosis.1. During a wound infection, the bacteria Clostridium perfringens produces collagenase, an enzyme that breaks apart collagen, as one of its virulence factors. What do you predict would be the most likely outcome of this collagenase production? A. Breakdown of connections and structure of the extracellular matrix B. Blockage of signal transduction C. Lysis of the phospholipid bilayer of cells D. Degradation of tight junctions 2 The primary cell wall of plants is made mostly of the structural carbohydrate ______, which is a polymer of the monosaccharide glucose. A. starch B.cellulose C.glycogen D.peptidoglycan 3. The protein integrin binds to actin filaments and, by binding to proteins like fibronectins, connects to collagen. In this manner, integrin ______. A.controls the permeability of the cytoplasmic membrane B. suspends organelles within the cytoplasm C. provides a direct linkage between the cytoskeleton and the extracellular matrix D. helps keep individual cells in place and…Why do cancer cells treated with vitamin E succinate appear to be more vulnerable to rupture of their lysosomal membranes (and subsequent apoptosis) than normal cells? A. cancer cells often have an alkaline cytosol, which destabilizes the acidic lysosomes B. cancer cells often have an alkaline cytosol, which destabilizes the alkaline lysosomes C. cancer cells often have an acidic cytosol, which destabilizes the acidic lysosomes D. cancer cells often have an acidic cytosol, which destabilizes the alkaline lysosomes E. all of the above
- In protein synthesis, modification and transport, what will be the correct order of organelles involved in the process? A. nucleus - ribosomes - Golgi complex - vesicles B. endoplasmic reticulum -ribosomes - vesicles Golgi complex C. Golgi complex - endoplasmic reticulum - vesicles - ribosomes D. ribosomes - endoplasmic reticulum - vesicles - Golgi complex One of the meristematic tissues is vascular cambium which is responsible for increasing the diameter of stems and roots. In which part of the plants is the vascular cambium found? A. In structure 4, where they are in the sides of stems and roots. B. In structure 3, where they are located at the base of leaves and internodes. C. In structure 1, where they are covered by lower and upper epidermis of the leaf . D. In Structure 2, where they are located on the tips of stems and roots of the plants .In protein synthesis, modification and transport, what will be the correct order of organelles involved in the process? A. nucleus - ribosomes - Golgi complex - vesicles B. endoplasmic reticulum -ribosomes - vesicles Golgi complex C. Golgi complex - endoplasmic reticulum - vesicles - ribosomes D. ribosomes - endoplasmic reticulum - vesicles - Golgi complexDoes the word 'biomolecular condensates' states that there is condensation during the formation of these organelles?