b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? Provide an alternative MRNA sequence with four changes that would translate to the same amino acid sequence.

b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? Provide an alternative MRNA sequence with four changes that would translate to the same amino acid sequence.

Name: b) Use the DNA sequence bęlow to answer the following questions.3' -
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: b) Use the DNA sequence bęlow to answer the following questions.3' - TACGAACGAGTGCCCCAAAATT -5'What is the complementary DNA strand?What is the nucleotide sequence of the mRNA strand transcribed from the initialDNA strand?Provide an alternative mRNA

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Use the mRNA coding chart above to answer these questions. he following is the base sequence on a portion of a template strand of DNA. 3 ‘ TACGCCAGTGGTTCGCAC 5 Give the base sequence of the complementary DNA strand. Give the base sequence of the strand of mRNA read from the original DNA template strand. List, in order, the amino acids that would be present in this protein? What would be the code that the methionine tRNA anticodon would carry? Suppose a mutation altered the original DNA strand so that the 6th nucleotide was changed to a T. i) How would this change the protein? ii) What type of mutation is this?
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? 3’-CATCGGAATAGATCGCTAGTGGCAGGCATAATGATCACCGGTCTGAGAAAAGTGGTACATATCAAC-5’
Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
Use the following information to answer the next two questions.A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. AUG CCC UUG GUC b. CGT AAA CCA ACT c. AUC GGG UUG GUC d. GCU AAA CCA ACU
Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart on the next page to answer the following questions. Partial gene sequence of DNA nucleotides: A C C T T A A T G A A C T C T 42. What is the mRNA nucleotide sequence that would result from transcription of the partial gene sequence of DNA nucleotides? 43. What is the protein amino acid sequence resulting from translation of the mRNA sequence from the previous question? 44. In the gene sequence of DNA nucleotides, guanine (G) is mistakenly replaced by adenine (A) during DNA replication. What type of mutation would this be considered based on how it occurred? ________ a) spontaneous b) gametic c) mutagenic d) carcinogenic 45. Consider the mutation from the previous question. If it occurred within a skin cell of the body, what type of mutation would this also be considered based on where it occurred? ________ a) gametic b) germline c) heritable d) somatic
Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis, including the functions of the molecules responsible for synthesis. 5’-ATCGCTTGTTCGGAA-3’ 3’-TAGCGAACAAGCCTT-5’
Which is the mRNA molecule that would be transcribed from this DNA template: TGGCAAGTACGT answer choices A.) ACCGUUCAUGCA B.) UCCGUUCUUGCU C.) ACCGTTCATGCA D.) UGGCAAGUACGU
Part of the protein-coding region in a gene has the base sequence 3- TACCGCAGCATAACGTTCGCAATCTACCGCTCCACCGGGTC-5'. What is the sequence of the partner DNA strand?
Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?
Assume that you are a RNA polymerase. Which strand is the template strand? -5 ↓ 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’