A1 The input file A1(input).txt has the following content for example: [a,b], [12, 'y']['1', 2, ¹2 3¹, x]: [ b, 123, ! ] Write a python program that can read and organize A1(input).txt into the output as shown below. Extra test line inputs may also be added by the examiner to fully test out your code's generality. Design your solution to be simple but general. Hints: Focus on using lists, for-loops, functions readlines, split, and replace. Extract bracketed contents: a, b 12, 'y' '1', 2, '2 3¹, b, 123, ! X Processed contents: a, b, One Two, y, One, Two, Two Three, x, b, One Two Three, !

A1 The input file A1(input).txt has the following content for example: [a,b], [12, 'y']['1', 2, ¹2 3¹, x]: [ b, 123, ! ] Write a python program that can read and organize A1(input).txt into the output as shown below. Extra test line inputs may also be added by the examiner to fully test out your code's generality. Design your solution to be simple but general. Hints: Focus on using lists, for-loops, functions readlines, split, and replace. Extract bracketed contents: a, b 12, 'y' '1', 2, '2 3¹, b, 123, ! X Processed contents: a, b, One Two, y, One, Two, Two Three, x, b, One Two Three, !

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter3: Input/output

Section: Chapter Questions

Problem 1PE: 1. Consider the following incomplete C++ program: #include <iostream> int main() { … } a. Write a...

See similar textbooks

Similar questions

Follow these steps:● Create a Python file called amazon.py in this folder.● Write code to read the content of the text file input.txt.● For each line in input.txt, write a new line in the new text file output.txtthat computes the answer to some operation on a list of numbers.● If the input.txt has the following:o Min: 1,2,3,5,6o Max: 1,2,3,5,6o Avg: 1,2,3,5,6● Your program should generate output.txt as follows:o The min of [1, 2, 3, 5, 6] is 1.o The max of [1, 2, 3, 5, 6] is 6.o The avg of [1, 2, 3, 5, 6] is 34
Write a Python program to combine each line from the first file with the corresponding line in the second file and then save it in a 3rd file. Consider, both the files have same number of lines. Assume, each line has a newline(\n) at the end. ========================================================= Example:Input from file 1:HelloHiNice Input from file 2:BadWorseWorst Output in 3rd FIle:Hello BadHi WorseNice Worst ========================================================= Hint(1):Use the write() function what will be the answer of this in python programming language
Run a python program that will: a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence. b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt *** ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py *** Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala Thr
Modify the program 11-10 from pages 753-755 as follows: 1. To Length class files (Length.h and Length.cpp) add the operator overload for stream insertion (<<) and stream extraction (>>) from page 759. You should not use the modified version of class Length from page 759 because it contains more operator overloads. Instead of typing you can use copy/paste from Length1.h and Length1.cpp respectively. 2. In main() replace the lines 11-16 with appropriate usage of stream extraction overload (>>) to change "first" and "second" objects with values inputted by the end user. 3. In main(), replace the output on lines 21,22 and 25,26 with appropriate usage of stream insertion (<<) operator. The resulting output should be identical with the unmodified version of the program. 11-10: // This program demonstrates the Length class's overloaded // +, -, ==, and < operators. #include <iostream> #include "Length.h" using namespace std; int main() { Length first(0),…
USE PYTHON Before there were emoji, there were emoticonsLinks to an external site., whereby text like :) was a happy face and text like :( was a sad face. Nowadays, programs tend to convert emoticons to emoji automatically! In a file called faces.py, implement a function called convert that accepts a str as input and returns that same input with any :) converted to ? (otherwise known as a slightly smiling faceLinks to an external site.) and any :( converted to ? (otherwise known as a slightly frowning faceLinks to an external site.). All other text should be returned unchanged. Then, in that same file, implement a function called main that prompts the user for input, calls convert on that input, and prints the result. You’re welcome, but not required, to prompt the user explicitly, as by passing a str of your own as an argument to input. Be sure to call main at the bottom of your file. ( Please see attached file for Demo) use PYTHON
Our requirement is to keep information of students who are taking “Introduction to Python” in Fall-2021 in a text file named ‘Students.txt’. The first line of text in this file will be header line as follows Write a python code that: Takes StudentID from user as input in a variable ‘inputID’, reads the file line by line and displays the header line and student information when inputID is found in Students.txt, otherwise display a message ‘Record not found in Students.txt’
write program code in java: Write a program that reads two files “Data1.txt”, “Data2.txt”; Then add their corresponding elements and produce an output file “output.txt”. If the number of elements are not equal, fill the elements of the smaller file up with “0” s. Sample output: Elements of the “Data1.txt”: 3 5 7 8 9 Elements of the “Data2.txt”: 45 11 Elements of the “Output.txt”: 48 16 7 8
Write a Python program in a .py file that includes the following: Program reads, formats and prints a restaurant menu from menu.txt (see at the bottom).Customer orders menu items by name or an assigned item number until a key word is entered such as "I'm Done" or "Exit".Customer order and net total is printed as output to a new text file. -----------------menu.txt-----------------Ham and Egg Sandwich $15.75Bacon and Cheese Plate $9.50Tuna Salad $12.30Beef Soup $9.00Spicy Beef Barbeque $20.00Pork Barbeque $18.00Oven Chicken Barbeque $15.00Pulled Beef Barbeque Burger $25.00House Salad $5.00Pellegrino $5.40White Wine $7.50Red Wine $11.00
Trace the following Code and then print the output. msg db 'hello world$' newline db 10,13,'$' buffer db 10 dup mov ah,9 mov dx,offset msg int 21h ;new line mov ah,9 mov dx, offset newline int 21h ;enter a string from the keyboard lea dx,buffer mov ah,0ah int 21h ;new line mov ah,9 mov dx,offset newline int 21h ;adding the $ symbol at the end of the string mov bx,0 mov bl,buffer[1] mov buffer[bx+2],'$' mov ah,9 mov dx,offset buffer+2 int 21h
Write a program to sort a list of numbers of unknown length. Your program must• read in a list (of unknown size) of numbers (think about types) from an input file namedinput.txt,• use a function, written by you, to sort the list in ascending order and• write the sorted list to an output file named output.txt.
This question concerns the use of a book cypher to encode a message.Write a program called ‘bookcypher.py’ that accepts:1. The file name for a Project Gutenberg book text.2. A message that is to be encoded.3. A file name for output of the encoded version of the message.The program will create an encoded version of the message by replacing its words with the locationsof words in the book.Say, for example, the message is ‘meet me at the usual time and place’, and the Gutenberg text is‘The Importance of Being Earnest’ by Oscar Wilde.• There is an occurrence of ‘meet’ as the 5th word on the 493rd line of the book text.• There is an occurrence of ‘me’ as the 9th word on the 190th line of the text.• There is an occurrence of ‘at’ as the 6th word on the 8th line of the text.• And so on.Representing a word position as a conjunction of the line number and the index of the word withinthe line, we can encode the message as 493-5, 190-9, 8-6, etc.Sample I/O (user input in bold):Enter the book…
1. Consider the following incomplete C++ program: #include int main() { … } a. Write a statement that includes the header files fstream, string, and iomanip in this program. b. Write statements that declare inFile to be an ifstream variable and outFile to be an ofstream variable. c. The program will read data from the file inData.txt and write output to the file outData.txt. Write statements to open both of these files, associate inFile with inData.txt, and associate outFile with outData.txt. d. Suppose that the file inData.txt contains the following data: Giselle Robinson Accounting 5600 5 30 450 9 75 1.5 The first line contains a person's first name, last name, and the department the person works in. In the second line, the first number represents the monthly gross salary, the bonus (as a percent), and the taxes (as a percent). The third line contains the distance traveled and the traveling time. The fourth line contains the number of coffee cups sold and the cost of each coffee cup. Write statements so that after the program executes, the contents of the file outData.txt are as shown below. If necessary, declare additional variables. Your statements should be general enough so that if the content of the input file changes and the program is run again (without editing and recompiling), it outputs the appropriate results. Name: Giselle Robinson, Department: Accounting Monthly Gross Salary: $5600.00, Monthly Bonus: 5.00, Taxes: 30.000 Paycheck: $4116.00 Distance Traveled 450.00 miles, Traveling Time: 9.00 hours Average Speed: 50.00 miles per hour Number of coffee Cups Sold: 75, Cost: $1.50 per cup Sales Amount = $112.50 e. Write statements that close the input and output files. f. Write a C++ program that tests the statements in parts a through e.