Again, at the making of this exam, the following numbers represent people that have been infected with the coronavirus on the west coast: (California 819,782 people), (Oregon 33,862 people) (Washington 87,522 people). What is the average number of cases per state?

Q: Predict how blood pH levels will change as a result of the kidney’s reabsorption or excretion of…

A: The buffer that maintains the pH of human blood involves carbonic acid (H2CO3), bicarbonate ion…

Q: Can you summarize and explain for me what you want to tell in the article below? When I read it…

A: The above article describes about the Interference with Cellular Uptake, Immobilization, and…

Q: Choose ALL the events listed below that occur in the cytoplasm of eukaryotes. Select one or more: a.…

A: In eukaryotic cell, translation process occurs in cytoplasm. Translation is the process, that…

Q: 126 Which products of the citric acid cycle are funneled into the electron transport chain? (give…

A: Introduction: A chain of compounds known as the "electron transport chain" uses the electrons from…

Q: 2. Using a reference, find the function of smooth muscle tissue in humans and one would find it.…

A: The hollow body organs like the bladder, colon, and stomach all contain smooth muscles. They are…

Q: Explain 3 possible reasons why coral reefs are so diverse?

A: Despite taking up less than 1% of our oceans, coral reefs are one of the planet's most diverse…

Q: The 02 to be utilized by the mitochondria of all eukaryote cells is produced by A) Oxidative…

A: Mitochondria is the cell organelles, found in most of eukaryotes. Mitochondria perform aerobic…

Q: Looking at this sample of a fungus, to what main group would it belong to? The first pic is the…

A: Studying fungi can be very beneficial for us as Fungi play an important part in "environmental…

Q: Did studying genetics help you change your perspective about what a human is

A: Genetics It refers to the study of genes and heredity. Heredity refers to the passing of genetic…

Q: Which of the following base sequences would be impossible to find on a DNA strand? A-T-A-T G-G-G-C…

A: The DNA consists of Adenine, Guanine, Thymine and Cytosine as nitrogenous bases.

Q: Opportunistic infections are often the proximal (most direct) cause of death in individuals with…

A: Opportunistic infections (OIs) are infections that affect persons with impaired immune systems more…

Q: What is the mass transfer by diffusion for t:slim insulin pump ?

A: introduction t:slim insulin pump is designed by micro delivery technology.  it This product costs…

Q: question: Can you summarize and explain for me what you want to tell in the article below? When I…

A: The given article is about Nanomaterial-Based Vaccine Development and Immunomodulation for COVID-19…

Q: If two species are competing for a resource, and one species is a much better competitor than the…

A: When two individuals of different species compete for food or a nesting site for an extended period…

Q: our short answer should be 2-5 sentences depending on the question. (Ch. 50). Please answer both…

A: The several kinds of sensations that humans are capable of perceiving are used to guide our motor…

Q: Some Traits in Garden Pea Plants In pea plants, the genes for seed shape, seed colour, and plant…

A: The method GREGOR MENDEL described as a cross to identify the hidden characters is known as a…

Q: Sometimes, genetic make-ups do not show up as traits. Let us assume Jane has beautiful brown eyes.…

A: Given:  Phenotype of Jane's father - blue eyes. Since her father has pure bred blue eyes, he is…

Q: Adherence to the intestinal lining by a bacterium may be due to its possession of _____. A)…

A: Bacteria are tiny, single-celled organisms that thrive in complicated habitats. These species will…

Q: Where on a neuron are you NOT likely going to find voltage-activated potassium, sodium, or calcium…

A: Our body has nerves that connect your brain to the rest of your organs and muscles. Our brain tells…

Q: Which of the following hypothetical islands would likely have the greatest species richness?

A: Biodiversity, often known as biological diversity, refers to the variety of life that can be found…

Q: 1. What are the reasons on why the growth factors added in culture media of some but not of all…

A: During effective cell culture studies, it's vital to investigate the morphology (or form and form)…

Q: Many organisms have a class of genes called ' heat shock proteins.' These genes are expressed at…

A:

Q: About 70 percent of all Caucasians can taste the chemical phenylthiocarbamide, and the remainder…

A: There is present single gene in the population. These are T and t. TT and Tt encode taster…

Q: How do virus infection and chemicals may cause cancer? Give examples and mechanisms.

A: A virus can only replicate and create new viruses by entering a live cell and taking control of the…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…

A: Annotating a genome involves finding functional components throughout its sequence in order to give…

Q: How does position effect influence gene expression? TI The movement y! CDC The movement of the…

A: ANSWER : The correct option is: All of the above answers are correct

Q: The sheep liver fluke is an organism that lives in the intestines, liver, brain, and lungs of sheep…

A: In case of multiple questions, first question is solved as per our company policy. If you want help…

Q: Which of the following is part of the extracellular matrix? A) All of the other answers are correct…

A: The fundamental building block of all living things is the cell. The trillions of cells that make up…

Q: Tick all the essential steps to demonstrate a genetic linkage between a disease and a molecular…

A: Genetic linkage is the tendency of certain genes to be inherited together due to their location on…

Q: RNA contains which bases?     cytosine, thymine, guanine, uracil   adenine, uracil, guanine,…

A: There are four nitrogenous bases present in the either DNA or RNA. Three of these bases are similar…

Q: Which of the following statements is not true about heritability? a. H^2 is always a number between…

A: Estimation of a trait's heritability is particular to one population in a particular setting, and it…

Q: how the bacterial cell acts like a fuel cell. Is it sustainable? Explain

A: Particularly in the transportation industry,  attention has switched to renewable  energy and fuel…

Q: How has the significance of science knowledge changed over the centuries from the point of view of…

A: Scientific knowledge is crucial to our understanding of the world around us and how it works. It…

Q: Concerning interface drug reactions, which statement is false? a. Most are caused by type II…

A: Dyskeratosis: Clinically characterized by the trio of aberrant nails, reticular skin pigmentation,…

Q: WHAT IS BLOOD CELL

A: Blood is a fluid connective tissue which is made up of Plasma and formed elements. These formed…

Q: Cells contain both DNA and RNA. What difference between the structures of these nucleic acids (that…

A: The DNA and RNA are nucleic acids found in the cells. DNA is present in the nucleus while RNA can be…

Q: Central African chimpanzees (Pan troglodytes troglodytes) and bonobos (Pan paniscus) are two…

A: The events that are responsible for the evolution of species from the ancestral population is called…

Q: WHEN do you think apoptosis occurs in humans? - What would be the effect if apoptosis doesn't…

A: ANSWER) Apoptosis is described as the natural programmed cell death occuring in the multicellular…

Q: How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming…

A: Formula: C=LNG   C stands for coverage G is the haploid genome length L is the read length N is the…

Q: Given the short-tandem repeats (STRS) of the child below. Which adults below could be the parents?…

A: A short tandem repeat is a microsatellite with repeat units of 2 to 7 base pairs in length, and the…

Q: BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal…

A: Antibodies produced by B cells of white blood cells engage specifically chemically with antigens…

Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive are crossed.

A: Genetic inheritance is the process of transfer of gene from the parent to progeny  Factor affecting…

Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…

A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…

Q: What kind of name that bug?

A: Being an insect it belongs to the Phylum Arthropoda. It has jointed appendages, contains exoskeleton…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: Tell me how this image shows the relation between grape and banana

A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…

Q: 14. Trace the route of inspired air in humans from the nostrils to the smallest chamber of the…

A: Lungs are essential parts of the respiratory system. A pair of lungs in humans are formed in such a…

Q: A. Soil Microbial Population As Affected by Enrichment 1. Types of colonies growing on TGYA plates…

A: Soil microbial population refers to the collective group of microorganisms (such as bacteria, fungi,…

Q: Which of the following statements is false about the impacts of climate change? Choose all that…

A: Increased temperatures, severe weather, ice melt, and rising sea levels are just a few of the…

Q: is false because while it is true that land conversion may reduce some risks associated with disease…

A: The option A is incorrect because  drought- and heat-induced increase of wildfires can have…

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.