How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming your read lenght is 600 bp? (assume a human genome size of 3 billion bp) - 2.5 billion - 75 million - 7 million - 100 million

How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming your read lenght is 600 bp? (assume a human genome size of 3 billion bp) - 2.5 billion - 75 million - 7 million - 100 million

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter13: Artifacts And Noise In Medical Instrumentation

Section: Chapter Questions

Problem 7P

See similar textbooks

Related questions

Q: In Deuterostomes, nutrient molecules (monomers) are taken in to the space between the endoderm and…

A: Option (a) is incorrect because, in Deuterostomes, nutrient molecules (monomers) are taken up into…

Q: What is a reasonable explanation for why the presence of cytosolic cytochrome c (Cyt c) is an…

A: Mitochondria are essential for controlling cell death. It has long been known that Ca2+ plays a…

Q: This descriptor refers to the number of alignments expected to match the sequence you have by…

A: A phylogenetic tree may be unrooted or rooted, suggesting directions that correlate to evolutionary…

Q: The amount of sodium in Bowman's capsule is determined by: A. Intracellular [Na] OB. Extracellular…

A: At the level of Bowman's capsule, amount of sodium will be only determined by the extracellular…

Q: Describe what occurs when a person experiences a chickenpox infection, including the cause, the…

A: Please follow steps 2 & 3 for detailed explanation.

Q: show me what the clade of banana and grape would look like

A: The term clade is associated with a collection of all the living and extinct members of that…

Q: Briefly explain how you can determine the presence of coliform bacteria in a water sample.

A: Coliforms are a type of bacteria. These organisms are normally harmless to the species or hosts they…

Q: 1) Compare and contrast population ecology, community ecology, and ecosystem ecology

A: Ecology derives from the Greek terms for "HOUSE" and "DISCUSSION/SPEECH," OIKOS LOGOS. The planet is…

Q: Please Drag and Drop the APPROPRIATE label to the HPT axis. TRH TSH Thyroid Hormone (T3, T4) HPT…

A: Endocrine glands are ductless glands that secrete hormones directly into the blood. Hormones are…

Q: GCTA A AAG GCG

A: Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed…

Q: The phase of the cell cycle in which cells perform thier cellular jobs is A) mitosis B) the G2 phase…

A: The sequence of activities that occur in a cell that leads to the replication of DNA and cell…

Q: 1. Who are at risk of having TB infection? (Tick the appropriate box) Risk group: HIV infected…

A: Some infectious pathogens can present in the air for longer periods of time. These microorganisms…

Q: Which of the following would be a normal gamete? a. 23Y b. 22X c. 46XY d. 46X

A: The karyotype of the human somatic cell is - 46 XX or [44 A + XX] for females 46XY or [44 A + XY]…

Q: Have an overview discussion on the mechanism of tissue invasion and metastasis in every organ system…

A: TThe movement of cancer cells from their initial site of formation to another area of the body. In…

Q: Explain how is the rasberry is related to strawberry, banana and grape?

A: Pollen is a plant's male reproductive cell. It results in the development of edible fruits and seeds…

Q: A 55 year old man who is overweight, a heavy drinker and habitual smoker is brought in to the…

A: Stroke : A obstruction in the blood supply to the brain or the rupture and bleeding of a blood…

Q: This refers to the percent of the sequence you put in that was included in the alignment.

A: Sequence alignemnt is a way to identify the similarity between sequences by arranging them in an…

Q: Both have a genetic disorder, but they already have one child who does not have the disorder. They…

A: The disorder is of autosomal dominant trait. The parents must be heterozygous dominant (bearing one…

Q: A mysterious young man who calls himself Matthew has appeared upon the doorstep of Yel. Matt claims…

A: PCR or the Polymerase Chain Reaction is a molecular technique that is used to amplify desired DNA…

Q: When will arm span and knee height be used? Are there any limitations on using these two methods?

A: When the accurate measurement for stature is unobtainable, other surrogates are used to predict…

Q: Describe in detail the three steps within the PCR reaction 2. Why do you also perform analysis on…

A: The very potent technology known as the polymerase chain reaction was created by researchers by…

Q: A deficiency in cholesterol will have the largest effect on the activity of what organ

A: Introduction:- Cholestrol is a type of sterol. Sterols are the class of steroids that have a…

Q: Per alone Fill in with the mRNA strand, then translate to the amino acid sequence #1 DNA: AT…

A: For the vast majority part, creatures retain their genetic information as DNA. Each individual cell…

Q: Mrs. and Mr. Bond have five children, Janine, Jaliyah, Joliette, Jelani and James Jr. Mr. Bond…

A: Given information Fragile X syndrome is an X-linked dominant disease. Mr. Bond has this disease…

Q: How to measure the muscle strength and muscle mass by using the anthropometric assessment

A: Anthropometric measurements provides the quantitative measurements of the body. This assess the…

Q: Which of the following is false about disease burden?

A: The term "communicable diseases" refers to illnesses that can spread from one person to another via…

Q: B. Next you isolate DNA from colonies and cut the DNA with the restriction enzymes you chose from…

A: A. As the plasmid contains ampicillin resistance gene, therefore, it confers resistance to amicillin…

Q: The amount of sodium in Bowman's capsule can be doubled by: O A. Doubling of glomerular hydrostatic…

A: Introduction The Bowman's capsule, a component of the nephron, creates a sack that resembles a cup…

Q: Steps to becoming human identify and describe each step and the are looking for in the fossil…

A: Anthropology is the study of human behaviour and societies in the past and present. It includes…

Q: The next several questions refer to the data given in this problem. You sample a population of…

A: The factors that induce changes in allele frequencies over time are natural selection, genetic…

Q: Based on the dental development image from the previous question, this individual is at least _…

A: Eruption of teeth is useful in estimating age. The developmental characteristics of eruption and…

Q: I know that Enterobacter Clocoae was supposed to test positive for the catalase test. My test…

A: Enterobacter Clocoae is gram negative bacteria, it is rod shape bacteria that has flagella all over…

Q: A hypothetical gene for cephalosporin resistance is found to be carried by a transposon. Explain…

A: The three primary modes of antimicrobial resistance are (1) enzymatic breakdown of antibiotics, (2)…

Q: Which of the following is NOT necessary for speciation to take place? Genetic divergence Physical…

A: Speciation is the evolutionary process by which a new species arises from an existing one. It…

Q: Outline the general process of transcription (dna->rna) include a diagram a) include the basic…

A: Transcription is the process of synthesis of RNA from DNA. It involves three steps, initiation,…

Q: Antibodies are found: O OOOO in the blood plasma on white blood cells in fibrinogen on red blood…

A: Antibodies are the proteins molecules that are synthesized by the B cells in the blood in response…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctqctc 61 tcggcggccc tggccctgac…

Q: . Magnifying Procedure lens 1. Look at the live specimen shown by your teacher which is like the…

A: The method that biology categorizes living things in accordance with their evolutionary lineage is…

Q: What are the dissimilarities between polyalphabetic and monoalphabetic ciphers?

A: Forensic science is involved with the gathering and evaluation of physical evidence as well as other…

Q: Using biotechnology, including PCR it is possible test many people for COVID-19 rapidly and…

A: PCR allows accurate diagnoisis of COVID-19 with theoritical sensitivity and specificity approaching…

Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 53). Please answer both…

A: The growth curve is an important part of a population which indicates the stability and…

Q: Proteins that bind to a specific DNA sequence and help control the recruitment of RNA polymerase are…

A: DNA, or the deoxyribonucleic acid, is basically the hereditary material in humans and almost all…

Q: 1Which of the following is NOT a consequence of global climate change? coral bleaching more ice at…

A: Climate change can change the pattern of species interaction as well as how they live, and the…

Q: IPTG (isopropylthiogalactoside) is commonly used to induce protein expression in Lac…

A: IPTG, also known as isopropyl d-1-thiogalactopyranoside, is a molecular biology tool. This substance…

Q: Next, it's important to understand how the gene would be transcribed and translated. 1 agagtctcct…

A: i. Coding region of this gene is 288 nucleotide long. ii. We all know that exons are the coding…

Q: Question 28 Ubiquinated proteins are transferred to large proteolytic machines for cleavage to…

A: The Ubiquitin is a 76 amino acid polypeptide that is attached to the proteins through the formation…

Q: mode: Arrange the following events in the correct order of expression during λ phage's lytic (a)…

A: Lambda phage is a virus that infects bacteria. It is one of the most extensively studied viruses and…

Q: Define what a pneumonia is, including what tissues are involved and what the consequences are for…

A: A bacterial, viral, or fungal infection of the lungs is known as pneumonia. Alveoli, the air sacs…

Q: Match the protein on the left with the mechanism of how the protein is activated on the right.…

A: Proteins can differ in terms of size, charge density, structure, and biological activity. Protein…

Q: What is one important advantage of using environmental DNA (eDNA), instead of traditional…

A: The environmental DNA methodology provides a number of benefits over conventional surveying…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming your read lenght is 600 bp? (assume a human genome size of 3 billion bp)

- 2.5 billion

- 75 million

- 7 million

- 100 million

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?
To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are required? a) 1 million b) 5,000 c) 100,000 d) 50,000
The human genome is approximately 3 billion basepairs in size.a. Using standard 8.5″ × 11″ paper with one-inch margins, a 12-point font size, and single-spaced lines, howmany sheets of paper printed on one side would berequired to print out the human genome?b. A ream of 500 sheets of paper is about 5 cm thick.How tall would the stack of paper with the entirehuman genome be?c. Would you want a backpack, shopping cart, or asemitrailer truck to haul around this stack?
By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 = 2.44140625 => 2.4 For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb) Please answer asap and type your answer and do not copy from anywhere please
In not more than 200 words, explain how the human genome of 3.4 Gb would be in 2.3 meters long when stretched linearly if this size is fit into a cell of minuscule proportions.
Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell if minuscule proportions
The plot shows a correlation between sequence error rate and cluster density on an Illumina flow cell. From your knowledge of how Illumina sequencing works, why do you think there is this correlation?
In computer science, a bit stores one of two states, 0 or1. A byte is a group of 8 bits that has 28 = 256 possiblestates. Modern computer files are often megabytes(106 bytes) or even gigabytes (109 bytes) in size. The human genome is approximately 3 billion base pairs insize. How many nucleotides are needed to encode asingle byte? How large of a computer file would it taketo store the same amount of information as a single human genome?
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
Explain the relationship among the following terms: genomics, proteomics, gene, protein, genotype, and phenotype. minimum of 500 words please!
Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp. A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?