Agent Step 1 Step 2 Nucleophile, Nu: Guanosine Leaving group, Y Electrophile ✗, part retained 3'-site phosphate Agent Nucleophile, Nu: Step 1 Step 2 2'01 BPA 3'-OH exon 1 Leaving group, Y 3'OH exon 1 3'0M intron 1 Electrophile X, part retained 5'-site phosphate intron I and extron 1 PO3 with nuclectide? 3'-site phosphate extron (1 and 2) POS with nucleotice?

Agent Step 1 Step 2 Nucleophile, Nu: Guanosine Leaving group, Y Electrophile ✗, part retained 3'-site phosphate Agent Nucleophile, Nu: Step 1 Step 2 2'01 BPA 3'-OH exon 1 Leaving group, Y 3'OH exon 1 3'0M intron 1 Electrophile X, part retained 5'-site phosphate intron I and extron 1 PO3 with nuclectide? 3'-site phosphate extron (1 and 2) POS with nucleotice?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
Which of the following statements is true?a) Exonuclease III removes nucleotide residues from the 3’ ends of a DNA strandb) Bacteriophage lambda exonuclease removes terminal phosphatesc) Alkaline phosphatase removes nucleotides from 5‘endsd) Kinase adds homopolymer tails to the 3’ –OH ends of a linear duplex
Nitrogen and carbon are more abundant in proteinsthan sulfur. Why did Hershey and Chase use radioactive sulfur instead of nitrogen and carbon to label theprotein portion of their bacteriophages in their experiments to determine whether parental protein or parental DNA is necessary for progeny phage production?
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
21. The difference between a nucleoside and nucleotide is: Group of answer choices 1. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has a sugar with a nitrogenous base and phosphate groups attached to the sugar. 2. Nucleotides contain deoxyribose sugar and nucleosides contain ribose sugar 3. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication 4. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has a sugar with a nitrogenous base and phosphate groups attached to the sugar.
Rabbits were in injected with [32 P] photsphate intraperitoneally ans asacrificed after 2, 5, 8, 12, 18, 24, 48, or 168 hours of radioisotope administration. DNA, nuclear RNA (nRNA), and cytoplasmic RNA (cRNA) were prepared from the kidneys and their specific activities (radioactivity/ mg of nucleic acid) were determined 1. what process was studied in this expereiement 2. What is concluded about the division of kideny cells during the time of labeling and why.
In the absence of cladosporin, explain the initiation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in the bacterial cell, with the involvement of all initiation factors, each site in the ribosome, any important conserved sequence, subunits of ribosomes, initiation codon, charged tRNA containing what amino acid, whether it requires ATP or GTP