ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT TACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGT TTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTC TCTGGGACCAATGGTACTAAGAGGTTTG   a) Assume that translation begins from the leftmost nucleotide in the above sequence. Provide the translated protein sequence for the first 5 amino acids. Please show your work.

Q: How is pancreatic enzyme secretion regulated?

A: Pancreatin or pancrelipase, a combination of amylase, lipase, and protease, is a component of…

Q: Steroid hormones exert their action by Select one: O a. entering the nucleus of a cell and…

A: Introduction Steroid hormone(SH), is any of a bunch of hormones that belong to the category of…

Q: The cells that carry out phagocytosis in nervous tissue are called and those cells that make up the…

A: According to biology's traditional idea of the nervous system, an animal's nervous system is an…

Q: Need a good explanatory answers. 1. Which reflections are best on lysosomes and vacuoles?.

A: Cell division generates considerable changes in both plant and animal cells. For example, following…

Q: Pathophysiology) 1. apply acute and chronic inflammation to select clinical models.

A: An initial physiological reaction to tissue injury, such as that brought on by mechanical, thermal,…

Q: Metro Water District is comparable to this organelle for its storage and supply of  water to the…

A: An organelle is a subcellular structure that, like an organ, has one or more specific jobs to do in…

Q: Differentiate between the “hot method” and “cold method” of acid-fast staining.

A: Introduction  A physical characteristic of several bacterial and eukaryotic cells, as well as some…

Q: Explain Superficial plantar Cutaneous sensation does not trigger barefoot running adaptations

A: The stimulation of sensory receptors as well as the central nervous system allows us to detect…

Q: Humans are a type of the following: O a. Organ O b. Organelle c. Organism Od. Organ System Oe. None…

A: An organ is a collection of numerous tissue coming together to form a functional unit to perform a…

Q: Question: 1 Posterior Pituitary Gland: W. Receives information through the hypophyseal portal…

A: The main function of your pituitary gland is to produce and release several hormones that help carry…

Q: need help

A: Photosynthesis is the process by which green plants prepared their food with the help of Sunlight,…

Q: Many different alleles of a gene may exist in a population, yet each individual within the…

A: Mutations are changes in an organism's DNA sequence. The health of an organism can be significantly…

Q: Instructions: Consider the following information and complete the three possible phylogenetic trees.…

A: Introduction  A phylogenetic tree is a branching diagram or tree that depicts the relationships that…

Q: Mentions the advantages of membrane bioreactors in water treatment

A: Membrane bioreactors (MBRs) combine membrane technology with biological processes to clean…

Q: Explanation of the operation of the membrane bioreactor

A: Explanation: A membrane bioreactor, often known as an MBR, is a technique for treating wastewater…

Q: Explain why it makes sense for the PDH complex in liver to be active when dephosphorylated.

A: Pyruvate Dehydrogenase Complex(PDH) is a multienzyme complex that is involved in pyruvate…

Q: Suggestion or ideas about paper inventions so that it will be more eco-friendly than a traditional…

A: Wood-pulp paper can be replaced by a wide range of different alternative "fibres." The following are…

Q: Compare the flexibility of the peptide backbone for the oxidised and reduced forms of the…

A: Explanation: The a-conotoxin is a disulfide-linked peptide, which means that it contains two…

Q: Olfactory neurons are stimulated by_____which causes the opening of______gated ion channels. These…

A: Olfactory neurons are present in the nasal epithelium, which has a lifespan of 2 months. It helps in…

Q: The following is made up of two or more different types of elements grouped together as a unit: O a.…

A: Elements  An element is a simplest unit which cannot be divided further by physical means.

Q: Binomial expansion 1. A couple who are both heterozygous for albinism plan to have eight children.…

A: Heterozygous  The condition where both copy of same gene having different alleles.

Q: Present a note on : Breast Cancer: The Ambiguities and Ethics of Genetic Testing

A: Genetic testing is the method by which one understand or test for genes or genome of an individual…

Q: How does the lipid or water solubility of hormones affect their transport in the circulation?

A: Hormones are chemical messenger which travels via the blood to various parts of the body to its…

Q: describe implantation of a blastocyte using simple label diagrams.

A: Introduction :  In males, the parent organism creates a haploid sex gamete known as sperm, and in…

Q: what areas (lake, pond, stream) would you expect to have the highest rate of productivity? The…

A: Productivity  In biological sciences, productivity means rate of production of biomass in an…

Q: Give the examples of epigenetic modifications ?

A: Genetic changes are the ones that are regulated by genes.

Q: QS2) Which of these statements is INCORRECT: a) More than 50% of the ATP produced from 1 molecule of…

A:

Q: 2. Create a line graph using the following data. Be sure to include all of the parts identified in…

A: When water converted to vapour sue to geat of sun , vapour condenses in the atmosphere. Water…

Q: 15. Some molecules that are covalently bonded do not have a difference in charge across the mol-…

A: The research of biochemical functions at the cellular and molecular level is known as biochemistry.…

Q: What is Control of Apoptosis ?

A: Apoptosis is also called programmed cell death.

Q: You observe amphophilic staining of myofibroblasts, why do these cells have cytoplasmic amphophilic…

A: The term "amphophilic" denotes that the tissue stains with both basic and acidic dyes. A…

Q: if we are not able to produce our own amino acids. Where do we source the important biomolecules?…

A: There are a few important points about the amino acids: Amino acids are compounds containing…

Q: Our policemen and soldiers help the city to be in its proper shape, ensuring the city is in order.…

A: Introduction  Inside cells, organelles are specialised structures that carry out a variety of tasks.…

Q: Doesn't the The F1 offspring being all LlDd means that the F1 centipedes have long legs and DARK…

A: The given data can be consolidated as follows L = dominant allele for Long legsl = recessive allele…

Q: order to reduce the social and economic burden, therapeutic methods to ND, such as AD and PD, should…

A: The paragraph is all about the cause of various neuro degenerative disease and the treatment plan.…

Q: Summthe lymphatics of the ( head , face and neck) , cervical nodes

A: A lymph is a collection of the extra fluid that drains from cells and tissues which are not…

Q: Define about this ? "Predisposition to Some Cancers Can Be Inherited"

A: Introduction: Cancer is a genetic disease that is caused to  somatic cells. Cancers are associated…

Q: On a separate sheet of paper, copy and complete the key points of the methods used to introduce…

A: Genetic engineering is a widely used technology in molecular biology in which genetic material is…

Q: Deep water coral, also known as cold water coral, are most often stony corals belonging to the…

A: The paragraph started with active voice with generalized statements/facts. Also, the end of the…

Q: Explain about the TP53 Tumor-suppressor Gene ?

A: Genes are the main reason for hereditary in organisms or humans. These are present in the…

Q: Is 100/60 mmhg a normal blood pressure or low blood pressure (hypotension) ? Please explain.

A: The force of blood against the arteries is referred to as blood pressure. An individual should…

Q: . In common wheat, Triticum aestivum, kernel color is determined by multiply duplicated genes, each…

A: The genes in the DNA code for a specific trait. Each gene has two alternative forms called alleles…

Q: 2. The N number of cows is 30, (a) What is the number of chromosomes in its epithelial cells? (b) In…

A: Introduction :  Haploid cells are those that have just one set of chromosomes. During fertilization,…

Q: Bacteriophage Lambda Describe the procedures you used to retrieve your gene of interest from the…

A: Bioinformatics gives information about the application of the intricacies of biological information.…

Q: Suppose 40 percent of people living in a remote, isolated mountain village can taste…

A: According to Hardy Weinberg equation in the absence of external forces the allele and genotype…

Q: 16. Divide these animal tracks using a dichotomous key: Beaver Black Bear for example: Has 5 Toes /1…

A: Dichotomous key is a technique used by the scientist in order to classify an organism like plant /…

Q: What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using…

A: Gene expression is the process through which the genetic codes of a gene, the nucleotide sequence,…

Q: The following is the site where a lipid is added to a protein to make a lipoprotein: O a. Nucleus O…

A: In eukaryotic cells, there is extensive compartmentalization as there are many membrane bound…

Q: *Genetics Matt observed 80 green frogs and 20 brown frogs. He knows from published studies,…

A: Alleles are alternative forms of a gene. In the case of Brazilian frogs, there are two alleles that…

Q: 1. From where are micromeres derived? Why are they smaller than macromeres? 2. In the early stages…

A: Introduction  The process through which a mother cell divides into two or more daughter cells is…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.