Homework Help is Here – Start Your Trial Now!
Science
Biology
b. You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown in the box on the right) immediately after the C/G base pair at positions, 100 or 150. Complete the table below for each of the following mutations. i. Effect on the length of mRNA (longer than/ shorter than/ same as the mRNA produced by the wild-type allele of Gene A). Explain briefly. ii. Effect on the length of protein (longer than/ shorter than/ same as the protein produced by the wild-type allele of Gene A). Explain briefly. iii. Does this mutation affect the reading frame? Why/why not iv. If the protein is produced, will it be functional? Explain briefly. U C A U bu sai si CSAneo yd be Аons ebias onima G UUU Phe (F) UCU Ser (S) UAU TYCY "1 "1 UUC UCC UUA Leu (L) UUG CUA CUG "1 "1 AUU Ile (I) 11 AUC CUU Leu (L) CCU Pro (P) CAU His (H) "1 11 " CUC CCC CAC CAA Gln (Q) 11 CAG AUA AUG Met (M) GUU Val (V) 11 GUC GUA GUG 11 Positions of insertions of the above three base pairs After 100th base pair After 150th base pair 11 UCA UCG 18 CCA CCG 11 11 11 ACU Thr (T) AAU Asn (N) 11 ACC AAC " ACA ACG "1 11 UAA Stop UAG Stop "1 11 AAA Lys (K) "1 AAG GCU Ala (A) GAU Asp (D) 11 11 GCC GAC GCA GAA Glu (E) "1 GCG GAG Cys (C) UGA Stop UGG Trp (W) CGU Arg (R) 11 CGC CGA CGG 5' CGA 3' 3' GCT 5' "1 11 AGU Ser (S) 11 AGC AGA Arg (R) AGG GGU Gly (G) 18 GGC GGA GGG "1 11

b. You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown in the box on the right) immediately after the C/G base pair at positions, 100 or 150. Complete the table below for each of the following mutations. i. Effect on the length of mRNA (longer than/ shorter than/ same as the mRNA produced by the wild-type allele of Gene A). Explain briefly. ii. Effect on the length of protein (longer than/ shorter than/ same as the protein produced by the wild-type allele of Gene A). Explain briefly. iii. Does this mutation affect the reading frame? Why/why not iv. If the protein is produced, will it be functional? Explain briefly. U C A U bu sai si CSAneo yd be Аons ebias onima G UUU Phe (F) UCU Ser (S) UAU TYCY "1 "1 UUC UCC UUA Leu (L) UUG CUA CUG "1 "1 AUU Ile (I) 11 AUC CUU Leu (L) CCU Pro (P) CAU His (H) "1 11 " CUC CCC CAC CAA Gln (Q) 11 CAG AUA AUG Met (M) GUU Val (V) 11 GUC GUA GUG 11 Positions of insertions of the above three base pairs After 100th base pair After 150th base pair 11 UCA UCG 18 CCA CCG 11 11 11 ACU Thr (T) AAU Asn (N) 11 ACC AAC " ACA ACG "1 11 UAA Stop UAG Stop "1 11 AAA Lys (K) "1 AAG GCU Ala (A) GAU Asp (D) 11 11 GCC GAC GCA GAA Glu (E) "1 GCG GAG Cys (C) UGA Stop UGG Trp (W) CGU Arg (R) 11 CGC CGA CGG 5' CGA 3' 3' GCT 5' "1 11 AGU Ser (S) 11 AGC AGA Arg (R) AGG GGU Gly (G) 18 GGC GGA GGG "1 11

Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Chapter15: From Dna To Protein
Section: Chapter Questions
Problem 8TYK
See similar textbooks
icon
Related questions
Topic Video
Question
You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown in the box on the right) immediately after the C/G base pair at positions, 100 or 150. Complete the table below for each of the following mutations. b. 5' CGA 3' 3' GCT 5' Positions of insertions of the above three base pairs After 100th base pair After 150th base pair i. Effect on the length of mRNA (longer than/ shorter than/ same as the MRNA produced by the wild- type allele of Gene A). Explain briefly. ii. Effect on the length of protein (longer than/ shorter than/ same as the protein produced by the wild- type allele of Gene A). Explain briefly. iii. Does this mutation affect the reading frame? Why/why not iv. If the protein is produced, will it be functional? Explain briefly. U bs Msni s CSASeo yd b A ebias orira G UUU Phe (F) UCU Ser (S) |UAU Ty UCC UUC UUA Leu (L) UCA UUG UAC UAA Stop UAG Stop UGU Cys (C) UGC UGA Stop UGG Trp (W) UCG CUU Leu (L) CCU Pro (P) CAU His (H) CGU Arg (R) CGC CUC C CỦA CCC ССА CCG CÁC CAA Gln (Q) CGA CAG %3D CUG CGG AUU Ile (I) AUC AUA AUG Met (M) ACG ACU Thr (T) AAU Asn (N) AGU Ser (S) ACC ACA AGC AAC AAA Lys (K) AGA Arg (R) AAG %3D AGG GUU Val (V) GCU Ala (A) GAU Asp (D) GGU Gly (G) GGC GAC GAA Glu (E) GGA GAG %3D GUC G GUA GCC GCA GCG GGG GUG
Transcribed Image Text:You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown in the box on the right) immediately after the C/G base pair at positions, 100 or 150. Complete the table below for each of the following mutations. b. 5' CGA 3' 3' GCT 5' Positions of insertions of the above three base pairs After 100th base pair After 150th base pair i. Effect on the length of mRNA (longer than/ shorter than/ same as the MRNA produced by the wild- type allele of Gene A). Explain briefly. ii. Effect on the length of protein (longer than/ shorter than/ same as the protein produced by the wild- type allele of Gene A). Explain briefly. iii. Does this mutation affect the reading frame? Why/why not iv. If the protein is produced, will it be functional? Explain briefly. U bs Msni s CSASeo yd b A ebias orira G UUU Phe (F) UCU Ser (S) |UAU Ty UCC UUC UUA Leu (L) UCA UUG UAC UAA Stop UAG Stop UGU Cys (C) UGC UGA Stop UGG Trp (W) UCG CUU Leu (L) CCU Pro (P) CAU His (H) CGU Arg (R) CGC CUC C CỦA CCC ССА CCG CÁC CAA Gln (Q) CGA CAG %3D CUG CGG AUU Ile (I) AUC AUA AUG Met (M) ACG ACU Thr (T) AAU Asn (N) AGU Ser (S) ACC ACA AGC AAC AAA Lys (K) AGA Arg (R) AAG %3D AGG GUU Val (V) GCU Ala (A) GAU Asp (D) GGU Gly (G) GGC GAC GAA Glu (E) GGA GAG %3D GUC G GUA GCC GCA GCG GGG GUG
1. The following is the partial DNA sequence of Gene A. Note: The underlined sequence (from position 20-54) represents the promoter for Gene A and the underlined and italicized sequence (from position 71-90 represents the ribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/A base pair at position 60. 10 20 30 40 50 60 70 --- 5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3 TAGCCAGAGCCGATGATGTATTTG TATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 --- 5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG 3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 --I- - -I- -- 5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT What are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint: Find the DNA coding strand, Note: A Genetic codon chart is provided on the next page of this problem set. a.
Transcribed Image Text:1. The following is the partial DNA sequence of Gene A. Note: The underlined sequence (from position 20-54) represents the promoter for Gene A and the underlined and italicized sequence (from position 71-90 represents the ribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/A base pair at position 60. 10 20 30 40 50 60 70 --- 5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3 TAGCCAGAGCCGATGATGTATTTG TATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 --- 5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG 3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 --I- - -I- -- 5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT What are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint: Find the DNA coding strand, Note: A Genetic codon chart is provided on the next page of this problem set. a.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Gene expression
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS