Because of the constant exchange of blood calcium and bone calcium, the concentration of calcium ions in the blood and tissue is very steady. Describe the process of calcium mobilization in bone tissue.

Q: What is Binomial system of nomenclature? Who proposed this system? Why is binomial nomenclature the…

A: Binomial Nomenclature Carolus Linnaeus in the 1750s gave the formal naming system to organisms…

Q: What are MHC class I and class II receptors and how do they recognize foreignness?   This is an…

A: MHC (Major Histocompatibility complex) is a type of transmembrane glycoprotein which are presented…

Q: Question 2 Which of the following is not a key step in the activation of MRNA synthesis in…

A: The nucleus uses the nucleotide sequence of DNA as a template to synthesize mRNA. The enzyme RNA…

Q: What is required to form a phosphodiester bond withanother nucleotide ?

A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: T or F. Motor signals originating in the cortex can't interfere with motor reflex response? T or F.…

A: 1) the correct answer is - TRUE but it has restrictions upto a limit. This statement is neither…

Q: When KO techniques was developed ?

A: The full form of KO is knock out and refers to gene knock out which means the gene that is knocked…

Q: Question 12 Alternative splicing A. happens when different set of exons are joined together B.…

A: Option d  A,C,D,E

Q: 3. Ehylene glycol, the main ingredient in antifreeze, is an odorless, colorless, sweet tasting…

A: In case of ethyl glycol poisoning, ethyl alcohol is and fomepizol is used for the treatment as an…

Q: State whether each of the following statements is True Or False. If it is False, explain why. (i)…

A: 1) Nucleated cells tends to be more resistant to compliment mediated lysis than red blood cells?…

Q: What is gene targeting? Give some examples of gene targeting?

A: Gene is a stretch of DNA in a chromosome  which codes for a functional product either in the form of…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: 1) DNA Sequence: THE BOY CUT HIS LIP AND ARE THE HOT DOG Insertion: THE BOY CCU THI SLI PAN DAR ETH…

Q: When in a cell cycle are the chromosomes actually replicated

A:

Q: Decide whether the statement is TRUE OR FALSE. Justify your answer. 1. Introns are coding regions of…

A: 1. Introns are coding regions of the DNA that becomes part of the mature mRNA after splicing.…

Q: Summarrize the laws and policies that relate to the practice of agricultural and biosystems…

A: It was An Act Strengthening, Modernizing and Aligning the Practice of Agricultural Engineering in…

Q: What is single molecule sequencing in real time (SMRT) ?

A: DNA sequencing is a technique for determining the order of the four nucleotide bases found in DNA:…

Q: Compare and contrast diffusion and convection. In what way dothey “alternate” in the O2 transport…

A: Introduction Diffusion is defined as the net movement of something from a higher to a lower…

Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…

A: Asexual and/or sexual reproduction are used by animals to make offspring. Both systems have benefits…

Q: 17a. Assuming that both types of pom-poms are present in the population, what do you think would…

A: *Natural selection is due to when individuals of genotypes are more likely than individuals with…

Q: What is the common ground between evolutionary biologists and developmental biologists who have…

A: Evo-Devo is well stated that they are been sued as the abbreviation for evolutionary developmental…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: The extent to which a given gene is transcribed depends upon (A the single transcription factor…

A: Transcription is a process where DNA converted into a mRNA. It has three step initiation, elongation…

Q: RNA molecules differ from DNA molecules in that they *   a. are single stranded rather double…

A: Codon is a sequence of three DNA or RNA nucleotides. Codons encode the amino acids which eventually…

Q: Give different kinds of molds that can be found in the fish body or other fishery products.

A: A mold is a fungus that grows in the form of multicellular filaments called hyphae, In contrast,…

Q: Can you describe a scenario in which public health and safety might be threatened by food crops…

A:

Q: At a high pH the overall charge on a diprotic amino acid is more [ Select ] than the overall charge…

A: The amino acid sequence of a protein can reveals information about its three-dimensional…

Q: Name the guidelines for naming of organisms?

A: There are much greater number and kinds of living organisms. Is different kinds of plan animal…

Q: A human disease example in which a dominant allele that is lethal in homozygous state is…

A: Solution Huntingon's disease is a non- sex linked dominant genetic trait which means males and…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Let suppose the coat colour is controlled by the gene A, As there are many traits for the coat…

Q: On a separate sheet of paper. A. Classify the Value of Biodiversity: Give the value of each organism…

A: INTRODUCTION  Biodiversity is referring to the diversity of living organisms that are interdependent…

Q: Question 16 The mechanism of activation of eukaryotic genes involves addition and removal of…

A: Gene is a stretch of RNA that encodes a functional product either in the form of RNA or a protein.…

Q: 1. Women who have been blind since birth almost never have breast cancer. A high level of one…

A: The pineal gland is a small endocrine gland located below the epithalamus of region of diencephalon…

Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?

A: P21cip1 is small 165 amino acid protein that mediates p53 dependent G1 growth arrest.

Q: What is the significance of the fact that couples who cannot taste PTC never have children who can?…

A: 1. couples who cannot taste PTC never have children who can taste PTC because when we cross between…

Q: Are the healthcare concerns, infections, and nosocomial infections discussed for genera…

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…

Q: U1 snRNP of the spliceosome bind to the 5' splice site to begin the RNA splicing * True false

A: U1 snRNP binds to the 5′ exon-intron junction of pre-mRNA and thus plays a crucial role at an early…

Q: 5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA…

A: RNA can be defined as a nucleic acid present in all living cells. It is similar to DNA, but differs…

Q: Explain the variation in diameter of skeletal muscle fibers and what type of muscle tissue undergoes…

A: Introduction Muscle fibers consist of elongated cells or a single muscle cell from 0.02 to 0.08 mm…

Q: Consider the following statements and indicate whether each presents an idea of Jean-Baptiste…

A: The evolution is the change in the characteristics of a species over several generations. It mainly…

Q: Order the listed proteins in the correct order so that cell proliferation is activated as the…

A: HGF stimulates epithelial cell proliferation, motility, morphogenesis via tyrosine phosphorylation.…

Q: What is the rationale for synthesizing and rapidly degrading p53 protein in the cell?

A: P53 is a nuclear transcription factor with pro apoptotic function as 50% of human Kansas carries…

Q: Agglutination is used only in vivo. to detect bacterial diseases. often as a substitute for…

A: Agglutination refers to the clumping of cells due to result of aggregation between antigen and…

Q: Construct a schematic representation of the circulatory designs of the mentioned vertebrates which…

A: Here I will provide you schematic representations of snakes, birds, fish, frog, mammals and…

Q: What evidence led Emil von Behring to discover antibodies and the complement system in 1905?

A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…

Q: During bacterial RNA chain elongation, ____ proceeds ahead of the transcription bubble introducing…

A: RNA chain elongation is called transcription. When transcription occurred in the transcription site…

Q: Monarch Monarch Species A Species B 0.5 I O Nomal Warmer Normal Warmer Climate Figure 1. The…

A: As the temperature increases, that is as the climate becomes warmer the concentration of…

Q: What is the other pathway of antigen processing? What is the advantage of having two distinct…

A: Antigen processing, also known as the cytosolic pathway, is an immune mechanism which prepares…

Q: Please answer fast What role do sigma factors play in prokaryotic transcription? Which sigma factor…

A: In prokaryotes (as in eukaryotes), transcription necessitates a partial unwinding of the DNA double…

Q: Worthiness of development 5= very worthy, 1= not worthy at all 5 4 3 2 1 Aspects Reasons Agriculture…

A: Genetic engineering, often known as genetic modifications, is the use of molecular techniques to…

Q: - research and explain about the genetic drift  -differentiate founder effect from bottleneck…

A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…

Tissue regeneration & repair

Tissue regeneration involves the restoration of tissue components by regrowth of damaged tissues. In contrast, tissue repair involves patching of injured tissue rather than restoring it. It is the proliferative capacity of the cells that decides the amount of regeneration against the repair that would occur in the tissue. Both regeneration and repair depending on the duration of the injury and response to the inflammation.