5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA molecules produced by eukaryotes. Compare their origin (how they are processed), size and their function within eukaryotic cells.

Q: What are the possible genotypes of the offspring if you cross a brown cow and a black cow? Black cow…

A: Here C is the dominant allele for black color and c is the recessive allele for white colour.…

Q: Discuss the significance of the Hardy–Weinberg principle as it relates to evolution and list the…

A: In the absence of disrupting events, the Hardy-Weinberg equilibrium implies that genetic changes in…

Q: 3. Ehylene glycol, the main ingredient in antifreeze, is an odorless, colorless, sweet tasting…

A: In case of ethyl glycol poisoning, ethyl alcohol is and fomepizol is used for the treatment as an…

Q: What are taxonomic aids? Mention some of the taxonomic aids for identification.

A: Taxonomy is the science of naming, describing, classifying organisms. The father of Taxonomy is Carl…

Q: Name the guidelines for naming of organisms?

A: There are numerous organism living on the surface of earth . Learning of these organisms is really…

Q: (b) Describe the role of invariant chain, CLIP, HLA-DM in the antigen presentation process.

A: Invariant chain plays important role in functioning of MHC class II molecules.

Q: How can researchers test the hypothesis that clinal variation among populations of a particular…

A: A gene is a functional unit on a chromosome that is passed down from parents to offspring in order…

Q: Select all examples of DNA transformation Check All That Apply Transfer of DNA through a pilus into…

A: The process through which an organism receives external DNA is known as transformation. There are…

Q: When can the regenerative capacity of the connective tissue clearly observed? And what specific…

A:

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Identify the benefits and risks of Genetically Modified Organisms

A: Genetical Modified Organisms in Plants Genetical modified plants is nothing but modifying the DNA of…

Q: Describe Class I MHC pathway of antigen processing and presentation. Highlight the functions of the…

A: The process by which foreign antigens are displayed on MHC, or major histocompatibility complex…

Q: Formulate an informed opinion regarding Genetically Modified Organisms

A: Q. Formulate an informed opinion regarding Genetically Modified Organisms

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: An epidemic may be detected by observing

A: Endemic is used to describe diseases that spreads rapidly to a large number of people of a given…

Q: What is the final electron acceptor for aerobic organisms?  What does this mean?

A: Aerobic respiration needs oxygen. It is the release of large amount of energy in cells by breakdown…

Q: You have now studied three different types of anatomical structures. Homologous structures show…

A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…

Q: Explain why IgM cannot activate complement by itself.

A: Antibodies which are also known as immunoglobulins are large Y shaped blood proteins produced by the…

Q: e tissue makeup for life on a large planet with strong gravity; a cold, dry climate; and a thin…

A: The cells responds differently to different types of conditions like varying temperatures, humidity…

Q: we read that in tumor cells Rb protein is hyperphosphorylated. In response to that, will p53 level…

A: Phosphorylation leads to interdomain locking, which alters the structure of pRb and inhibits it from…

Q: Which of the following is NOT true regarding the alternative complement pathway? It can be triggered…

A: There are three types of complement pathways: Classical pathway Alternative pathway Lectin pathway

Q: Discuss different systems of biological classification briefly.

A: In biology, classification is the process of arranging organisms, both living and extinct, into…

Q: Who developed the sequencing-bysynthesis (SBS) approach? & When it was firstly used ?

A: Sequencing by synthesis (SBS), an Illumina sequencing method, is a commonly used next-generation…

Q: My Diagnosis for Pati Sex: Chromosomal Disorder Justification:

A: Chromosomes are the parts of your cells that contain your genes. Genes are parts of DNA passed down…

Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…

A: Asexual and/or sexual reproduction are used by animals to make offspring. Both systems have benefits…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: The guinea pig, also known as the domestic guinea pig, is a rodent species in the Caviidae family.…

Q: What is gene targeting? Give some examples of gene targeting?

A: Gene is a stretch of DNA in a chromosome  which codes for a functional product either in the form of…

Q: Provde real exmaples of Public health strategies and campains of the prevalence of diabetes.

A: Diabetes can be described as condition in which blood glucose or blood sugar, becomes too high in…

Q: Independent assortment means that:   the segregation of one gene pair occurs as if no other gene…

A: The law of independent assortment states that the alleles of different genes are inherited…

Q: Anatomical structures that share a common ancestry are called __________structures. *

A: This question is based on homologous and analogues structure.

Q: All may be RNA polymerase II promoter constituents EXCEPT:   response elements or GC box   a TATA…

A: Transcription is process where mRNA formed. a promoter is a sequence of DNA to which proteins…

Q: READ THIS: Notice that natural selection does not refer to indiv Trequency of adaptive heritable…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…

A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…

A: Lowest weight = 5 lbHighest weight = 29 lbWeight difference = 24 lb 3/768 = 1/256 Four genes each…

Q: Modification of histone proteins include the following EXCEPT A phosphorylation of serine residues B…

A: Histones are basic proteins found in chromosomes that bind to DNA and give chromosomes their shape…

Q: Define microevolution.

A: Introduction:- Evolution is the process of a species' features changing over numerous generations…

Q: Cystic fibrosis is a recessive Mendelian disorder. An individual must have two copies of the…

A:

Q: Which of the following is not used as an evidence of evolution? *   A. DNA B. Fossils C. Homologous…

A: Answer is D. Niches

Q: You live in a community with cell sites (or cellular-based stations). You ther thinks that this…

A: INTRODUCTION Cell sites or cellular-based stations are defined as a set of equipment that is needed…

Q: Explain how and why the queen honey bee abort the sexual maturation of the worker bees?

A: Honey bees are eusocial insects.These insects have permanent division of labour.

Q: provide an example of a clinical scenario where a Type A patient has wild type A alleles at the ABO…

A: The ABO blood grouping is controlled by an 'i' gene. This gene has two alleles iA and iB. Both these…

Q: The hemoglobin in mammalian blood is usually thought ofsimply as increasing the amount of O2 that…

A: Introduction :- Hemoglobin is a protein found in red blood cells that allows blood to transport…

Q: Question 8 Modification of histone proteins include the following EXCEPT A phosphorylation of serine…

A: Histones are highly basic proteins that compress DNA within the nucleus to produce chromatin, which…

Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…

A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…

Q: If your footprint is greater than 1.72 hectares, outline a plan to reduce your footprint.

A: Ecological Footprint: A person's or a community's environmental footprint, measured in terms of the…

Q: Agglutination is used only in vivo. to detect bacterial diseases. often as a substitute for…

A: Agglutination refers to the clumping of cells due to result of aggregation between antigen and…

Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the RNA for…

A: Post transcriptional modification  It is a biological process in eukaryotic cell where primary…

Q: What seems to be the function of the spindle fibers ?

A: Spindle fibers are a network of threads like filaments that are forms during the cell division…

Q: reduction potential

A:

Q: why is polyspermy lethal in an egg cell?

A: Polyspermy is defined as the introduction of two or more sperm cells into the cytoplasm of an egg.

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.