What is the shape of the following cells:       vibrio     bacilli     cocci     spiral

Q: Select all the true statements about cyclins: (select all that applies) Group of answer choices Th...

A: Cyclins : These are named because they undergo  a constant cycle of synthesis and degradation during...

Q: Cross C: Homozygote wild type flies (+/+) were crossed with white eye flies. for the F1 and F2 gener...

A:

Q: Draw and write about the DNA

A: DNA is double helical in nature. It's structure was discovered by Watson and Crick. It is made up of...

Q: Why would multi-gene families complicate things in terms of being sure of which member of the family...

A: It is the gene which ultimately determines the phenotype. Thus there is a direct relationship betwee...

Q: Connie accidentally touched the hot kettle. Explain what happens using your knowledge of withdrawal ...

A: Withdrawal reflex is automatic withdrawal from painful stimulus..

Q: What is the significance of mapping the human genome?

A: Human genome : It is a complete set of nucleic acid sequences for humans , encoded as DNA within the...

Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...

A: Answer:- An allele is the alternative and variant form of a gene, which is located on the same loc...

Q: Breast feeding confers what type of immunity to an infant? O Artificially acquired active

A: The immune system is the human body's defence mechanism against foreign particles such as bacteria, ...

Q: You find a plant with four basic plant adaptations. Which adaptation would most direcly indicate tha...

A: Q.Chlorophytes and land plants have the following characteristics in common: Ans)both include specie...

Q: Drag the statements to the organisms they describe in order to test your knowledge of notable protis...

A: Protista: it is a group of single celled eukaryotes. It includes protozoa, Euglenoids, Dinoflagellat...

Q: What is genetic disorders? Explain by giving an example.

A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...

Q: What is the purpose of examining your specimen slide using low power objective first nefore high pow...

A: Objective lens are magnifying lens that functions to magnify an image. These lens make an important ...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: Which of the following best describes C-3 photosynthesis? Check all that apply.

A: C3 mode of photosynthesis is an inefficient way of photosynthesis compared to C4 and CAM respiration...

Q: Give possible ways of grouping protozoans other than the existing taxonomic classifications of proto...

A: Protozoans are a group of unicellular eukaryotes. Protozoans are currently classified into 4 groups....

Q: glutamate when it binds to postsynaptic AMPA receptors

A: glutamate is the main excitatory neurotransmitter in the central nervous system, it primarily intera...

Q: What is cloning? How is it done?

A: Introduction: The DNA molecules produced through the cloning techniques are used for many purposes. ...

Q: Molecule #T ajvvnat up? (Cal Lipiu, Acid). b)Within the group, how would you classify it? CH̟OH a) H...

A: First molecule shown is a monosaccharide. Different or same monosaccharides join via glycosidic link...

Q: first and second division after the egg is ferlilized is mitosis or meiosis.

A: Fertilized egg is called zygote it undergo first cell division mitosis and develops as embryo Zygote...

Q: If an organism is 2n=12, How many chromatids are present in prophase of mitosis? 1. 6 How many bival...

A: The indirect process of cell division by which the somatic parent cell divides once to produce two d...

Q: Q14

A: The sensitiveness of an organelle to a particular stimuli is based on the fact that how it reacts in...

Q: 1. I. What molecule holds instructions tor the synthesis of proteins and copies itselt tor the next ...

A: Introduction :- Proteins are macromolecules that are polymers of structural units known as amino aci...

Q: Placentals Marsupials Monotremes Mammals AMNIOTA Birds Crocodiles Lizards + Snakes TETRAPODA Tuatara...

A: Agnathans are different class from Gnathostomata. So it is placed as a different node in the table w...

Q: Please answer fast If the plasmid Lac operon has a mutated lacO operator gene that prevents the rep...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: ) Does the fossil record indicate that life first appeared in the water or on the land?            ...

A: Fossils are the preserved remains of plants and animals whose bodies were buried in sediments. like ...

Q: ch below with axygen level and function for each heart section. Function: Only identify where the bl...

A: Heart: it is an organ that pump the blood across the body via vascular system.  Vascular system: it ...

Q: Imagine you are working in a genetics lab with the fruit fly Drosophila melanogaster, a model organi...

A: Fruit flies are tiny insects that eat fruits and vegetables. Its scientific name is Drosophila. The ...

Q: It a student placed a starch in the beaker liquid and iodine solution inside the dialysi tubing bag,...

A: Iodine solution is a good indicator molecule, especially a starch or glycogen indicator. It is a che...

Q: Platelets are capable of which of the following? Select all that apply.   activate clotting enzymes ...

A: Platelets:- Platelets are tiny blood cells that help your body form clots to stop bleeding. Activati...

Q: The primary organ that regulates our hunger is? A. The liver B. The stomach C. The brain

A: Hunger is an uncomfortable or painful physical sensation caused by insufficient consumption of dieta...

Q: In an insect species, the genes for white eyes (w) and smooth legs (s) are linked and are located 16...

A: In genetics, genes forms the hereditary units of life. The genes contains two alternative forms call...

Q: From the options below, select the most likely effect of a mutation that causes cyclin B to be unabl...

A: Cell division is of two types: mitosis  meiosis

Q: What would happen to the red blood cells of a patient who was treated with 10% saline?

A: Red blood cells are the most common erythrocytes or blood cells in the circulatory system. It helps ...

Q: Lebel the fish and show the image

A: FISH labeled diagram 

Q: Match the numbers with the correct structure names 1 aorta tricuspid valve left ventricle

A: Heart: human heart has four chambers as follows- right atrium, right ventricle, left atrium, and lef...

Q: How did the energy-related organelles arise?

A: The cell is usually defined to state that they are been as the most fundamental structural and funct...

Q: how are the organelles in a cell similar to the organs in a human body?

A: Answer 

Q: Enumerate the functions of spleen

A: The spleen is a lymphatic organ that is part of the body's lymphatic system. The spleen is responsib...

Q: Which of the following structures is a vesicle?   Question 2 options:   lysosome   ribosome   mi...

A: The cell is the smallest structural and functional unit of the living organism. Eukaryotic cells con...

Q: A 25-year-old woman presents to the physician with a complaint of several episodes of headaches in t...

A: Henry Parinaud was the ophthalmologist that first described the eye movement disorder and he was the...

Q: Write the word TRUE if the statement is correct and if not, underline the word or statement that mak...

A: Introduction:-  1. The first genetically modified organism to be created was a bacterium, in 1973. S...

Q: Kutritional módes for each of the following organisms: (1) solely photoautotroph, (2) solely chemoau...

A: The basic mode of nutrition can be divided into autotrophic (green plants) and heterotrophic nutriti...

Q: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...

A: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...

Q: 1. What is the drug target?

A: Drug is any substance that is used to prevent, diagnose, treat, or relieve symptoms of a disease or ...

Q: The endocrine system is composed of glands that secrete hormones that regulate the activity of diffe...

A: The pituitary gland is called the master gland because hormones secreted by it control the activitie...

Q: How do we determine the essential amino acid residues?

A: Proteins are the building blocks of the body. It plays an essential role in the body. Proteins are m...

Q: 28. Given the relative proportion of DNA that directly codes for genes, is it reasonable to say that...

A: Introduction :- A gene is a basic unit of heredity in biology, consisting of a sequence of nucleotid...

Q: Complete th information and identify Role 1. The hor stimulates of ovarian 2. The hor: secreted by l...

A: Hormones : These are the chemicals which are released in body  These chemicals acts as a messenger w...

Q: The water oak tree in your backyard is home to two cardinals, a colony of ants, a wasp's nest, two s...

A: Introduction:- Ecology is a science that includes human science, population science, community scien...

Q: Please match the Arthropod subphylum or class to the description. two pairs of antennae [ Choose ] [...

A: Arthropoda is a largest phylum in Animal kingdom. 

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.