Kutritional módes for each of the following organisms: (1) solely photoautotroph, (2) solely chemoautotroph, (3) solely chemoheterotroph, (4) solely photoheterotroph (5) mixotrophs (both photoautotroph and chemoheterotroph). (Please only answer with NUMBER. NO LETTERS.) (A) green algae= type your answer. (B) yeasts= type your answer. (C) Venus fly-trap plants= type your answer. (D) the bacteria living inside of the tubeworms at the hydrothermal vents type your answer.

Q: You find a plant with four basic plant adaptations. Which adaptation would most direcly indicate tha...

A: Q.Chlorophytes and land plants have the following characteristics in common: Ans)both include specie...

Q: Give possible ways of grouping protozoans other than the existing taxonomic classifications of proto...

A: Protozoans are a group of unicellular eukaryotes. Protozoans are currently classified into 4 groups....

Q: Please answer fast If the plasmid Lac operon has a mutated lacO operator gene that prevents the rep...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: What type of tissue is the heart made out of

A: Introduction:- Tissues are a collection of cells that have a similar structure and perform the same ...

Q: ds. QUESTION 9 For each of the following chromosome combinations in humans, what is the phenotypic s...

A: Gametes can be described as the reproductive cells comprised of sex determining chromosomes. The chr...

Q: How many bones in the human body

A: Bones provide structural support and rigidity to different organs of the body. They form attachment ...

Q: List out Bone loading bearing's material properties (in bullet point) Explain each!

A: Bone loading : The tibias found in the lower leg below the knees are weight bearing bones . It is on...

Q: The endocrine system is composed of glands that secrete hormones that regulate the activity of diffe...

A: The pituitary gland is called the master gland because hormones secreted by it control the activitie...

Q: Explain what makes Thomas Hunt Morgan an interdisciplinary thinker with his Fruit fly discovery

A: Morgan chose the fruit fly, Drosophila melanogaster, for his genetic studies. fruit flies may lack i...

Q: During a flame test, why is it necessary to use a new splint for each element?

A: A splint is a thin wood/stick used commonly in laboratory for performing a flame test. The splint is...

Q: Please answer fast Briefly describe the pathways the body can use to make each of the Big Four clas...

A: The 4 classes of macromolecules are -  carbohydrate  Lipid  Protein  Nucleic acid  Carbohydrate pr...

Q: Please answer fast In a population of rats on an island, fur color is determined by one allele wher...

A: All cellular organisms are made of cells. Cells are the basic building blocks of life. Cells contain...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: Which statement best describes the primary difference between bacteria and protists? In terms of cel...

A: Correct statement is  In terms of cellular organization, bacteria are single-celled microbes and are...

Q: hemolymph circulation

A: Hemolymph is a fluid, analogous to the blood in vertebrates, that circulates in the interior of the ...

Q: What role does understanding the origins of the insect alimentary canal have in comprehending each d...

A:   INTRODUCTION        In insects, their digestive system make their nutrients and other sources of s...

Q: Stickleback fish that are deep in the ocean can experience a mutation wherein they experience a "los...

A: Introduction: Homozygous refers to a particular gene that has identical alleles on both homologous c...

Q: Sexual adjustment is best viewed as a relationship issue, not just one partner’s problem. T or F?

A: Human beings are social animals. The first man on Earth was a cave man. No societal rules and regula...

Q: Please match the Arthropod subphylum or class to the description. two pairs of antennae [ Choose ] [...

A: Arthropoda is a largest phylum in Animal kingdom. 

Q: occurring

A: The Department of agriculture regulates field testing of GM crops for research. The environmental pr...

Q: The Environment Act 2008 was repealed by the Environment Act 2002 True False

A: The Wild Life (Protection) Amendment Act, 2002 is an Act to provide for the protection of wild anima...

Q: Which of the following are mechanisms which prevent clotting under normal circumstances? Select all ...

A: Blood clotting is a complex phenomena which usually occurs when due to any reason blood vessels are ...

Q: In birds of paradise that populate tropical rainforest ecosystems, bright colored beaks and feathers...

A: In the ecosystem of tropical rainforests, most of the birds have bright colored beaks and feathers. ...

Q: What makes the stomach unique? A. Its ability to perform mechanical digestion B. Its tolerance of a ...

A: Let's see which statements are wrong to identify the correct answer:- Option A is Incorrect because ...

Q: Hypothesize  as to why iron can have an impact on bacterial growth, particularly S. Typhimurium, S.e...

A: INTRODUCTION Iron is an essential element for bacterial growth. Because it's participation in tricar...

Q: The creation of the Covid 19 vaccine is said to build the body's immune system or defense mechanism ...

A: Different types of vaccines provide protection in different ways. However, all vaccines leave the bo...

Q: Does the ATP synthase protein complex have to be located precisely on the membrane in relation to wh...

A: Plants and many other photosynthetic microorganisms use sunlight to generate food and energy.  This ...

Q: What is the virulence factor of Mycobacterium tuberculosis

A: Virulence factors are specific molecules of pathogenic organisms that cause the invasion against the...

Q: 1. Consider a locus having two alleles Aj and A2, If the homozygote A1A1 and the heterozygote A1A2 h...

A: Introduction :- The relative frequency of an allele at a specific locus in a population, expressed a...

Q: The den network of fibers that connect the two hemispheres is called the corpus Callosum. Much of wh...

A: The left and right hemispheres of the brain are symmetrical. The opposing side of the body is contro...

Q: The water oak tree in your backyard is home to two cardinals, a colony of ants, a wasp's nest, two s...

A: Introduction:- Ecology is a science that includes human science, population science, community scien...

Q: hat is DNA

A:

Q: 2 6 5 MAGIC CUP 3.

A: The above image  shows different types of sharks, the identification of these are: 1) Rhincodon typu...

Q: Explain the relationship between turgor and osmotic pressure

A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...

Q: It a student placed a starch in the beaker liquid and iodine solution inside the dialysi tubing bag,...

A: Iodine solution is a good indicator molecule, especially a starch or glycogen indicator. It is a che...

Q: Please help me answer this reviewer. Determine what the statement is describing. Fill in the blanks...

A: 1. Non-lethal storage of biological material at ultra-low temperature that almost all metabolic acti...

Q: 2. Indicate possible patterns of inheritance for the RARE traits shown in each of the pedigrees belo...

A: This particular pedigree shows following traits: 1. The affected trait appeared in generations in wh...

Q: egarding the endocrine system, which of the following statements is FALSE? A. Hormone secreted durin...

A: Various physiological systems constitute the human body. There are a total of 12 organ systems in th...

Q: The Convention on the Protection of Fauna and Flora in its Natural State of 1901 is the oldest conve...

A: Conservation refers to the meticulous preservation and upkeep of a natural resource in order to avoi...

Q: 2. Examine this pedigree chart. mode of inheritance is shown? Explain how you arrived at this decisi...

A: The pedigree chart shown here is a popular tool used in Genetics to explain the mode of inheritance ...

Q: Which biotic and abiotic factors are different between a lion and a deer?

A: The lion and deer are both important members of the food chain and may coexist in the same area. Lio...

Q: E. Discuss the difference between Amoebic from Bacillary Dysentery.

A: * Since you have asked multiple questions in a single question. So only 1st question i.e. E will be ...

Q: What is the purpose of the Kreb's Bicycle in nitrogen metabolism? Include in your description where ...

A: Introduction: The reactions which help in converting pyruvic acid to carbon dioxide and water in mit...

Q: Give short description to explain how motor coordination and balance are regulated.

A: A nervous system is defined as an organized group of cells called neurons that are specialized for t...

Q: A metabolic pathway_____ . a. may build or break down molecules b. generates heat c. can include red...

A: A metabolic pathway is a set of chemical events seen in biological processes that aid in the convers...

Q: embryos are exposed to this drug during an early stage of organogenesis, they develop severe skeleta...

A: Hox genes are involved in embryonic development as well as in mechanisms in the adult body , thus it...

Q: Multiple Alleles:

A: Given: Gene mutations may produce many different alleles of a gene. Some genes may have as many as 3...

Q: If an organism is 2n=12, How many chromatids are present in prophase of mitosis? 1. 6 How many bival...

A: The indirect process of cell division by which the somatic parent cell divides once to produce two d...

Q: Problem 3. In a population of cattle, the frequency of allele R is .7 and of allele r is .3. Also, t...

A:  Frequency change due to mutation in different generation: Rt=R(1-m)t Rt=change in allele frequency ...

Q: 10. A population geneticist collected 400 deer mice from the wild. All have normal ears. She raised ...

A: Answer - The laboratory mouse, also known as a lab mouse, is a tiny rodent from the order Rodentia t...