Bonuses: Assume that a cell from a particular species has a diploid number of 32 (n=16). How many chromosomes will there be in a gamete from this species? . . Will the Will the chromosomes in these daughter Following meiosis I, how many chromosomes will there be in the daughter cells? daughter cells be diploid or haploid? cells be single or duplicated? • If a cell from this species were undergoing mitosis, how many chromosomes would there be in a cell during anaphase of mitosis?

Q: A human who has the Klinefelter syndrome (XXY) has the normal number of and will produce the normal…

A: Klinefelter syndrome affects males as the affected individuals are born with two X chromosomes…

Q: Part I Analysis Questions: 1. When a corn plant with all purple kernels is crossed with a corn plant…

A: Since you've asked multiple questions, we're only answering the first three questions for you. If…

Q: In humans the allele coding for normal metabolism of the amino acid phenylalanine (P) is dominant…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: scientists continue exploring other planets and our solar system, they seek evidence to prove that…

A: Introduction: The composition of molecule of water (H2O) is made up of two hydrogen atoms and one…

Q: Part of the food losses each year are due to the unique characteristics or difficulties associated…

A: Introduction: Post-harvest systems refer to the processes and activities that occur after a crop has…

Q: How has the digestive system evolved when comparing the pig to the lamprey and the shark?

A: The digestive system in pigs, lampreys, and sharks consists of the mouth, esophagus, stomach, small…

Q: During transcription, only some of the DNA bases are transcribed. What parts of the DNA or/and…

A: Transcription is the first step in gene expression, the process by which genetic information is…

Q: The inherited component of a phenotype is determined by the:     age of the organism…

A: Phenotype simply means a distinguishable characteristic.  Pheno, which has the same root as the…

Q: 1. Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on…

A: Introduction Homologous chromosomes are pairs of chromosomes that have the same structure, gene…

Q: Quest Whi

A: Introduction: A sense organ is a specialized structure in the body that is responsible for detecting…

Q: 3:25 PM Wed Feb 8 M Acellus national Academy of Science. All Rights Reserved. Diffusion/Osmosis . To…

A: Introduction :-   Diffusion is a type of passive transport that occurs as a result of the natural…

Q: 6.Distinguish between a mole and the molecular weight of a substance

A: A molecule is a group of two or more atoms that are chemically bonded together. In a molecule, the…

Q: Which of the following statements would apply to a bacterium that is found living in a glacier? Mark…

A: Bacteria are a diverse group of microorganisms that are found in many different environments,…

Q: Evidence points to mutations more often being neutral than adaptive true or false

A: Introduction :- A mutation is a change in the DNA sequence that makes up an organism's genes. These…

Q: rotifers feed more on unicellular yeast

A:

Q: Provide 5 membrane bound organelles and their functions.

A: Introduction :  Organelles with a biological membrane around them are called membrane bound…

Q: 1) Visualization and 2) Electrophysiological

A: To monitor the trafficking of AMPA receptors during LTP, we can design an experiment using the…

Q: Process Synthesis A process for isolating an anti- body against insulin has, as a unit operation,…

A: Introduction :  The beta cells of the pancreatic islets of Langerhans release insulin. Along with…

Q: 1) having dimples D is dominant over not having dimples d. A dimples woman whose father had no…

A: Introduction  Dominant refers to an allele that masks the effect of a recessive allele when both are…

Q: 7. In 2010, a boating company in Fiji began taking tourists onto the ocean to view bull sharks. They…

A: Introduction  A population is a group of individuals of the same species that live and interact…

Q: Question Completion Status: QUESTION 2 In the fermentation part of this lab, we are measuring the…

A: Introduction :- Fermentation is a type of metabolic process that occurs in the absence of oxygen and…

Q: hallmarks of an autosomal recessive trait

A: The hallmark feature of an autosomal recessive trait are:…

Q: Alfred Russel Wallace came up with natural selection. true or false

A: Introduction  Natural selection is a process of evolution that occurs as a result of certain…

Q: What would be the genotype(s) of F2 offspring that carry recombinant chromosomes? (Note: recombinant…

A:

Q: provide a paragraph on sexual dimorphism. discuss why some species have pronounced dimorphism, and…

A: Introduction :- Sexual dimorphism refers to the differences in physical appearance and…

Q: The figure below shows a comparison between humans (Homo sapiens) and each of the listed species for…

A: Introduction :- The mitochondrial genome refers to the complete set of DNA located in the…

Q: Describe what biomarkers are used by electrochemical immunosensors to treat tumor cancers

A: Electrochemical immunosensors are   easy-to- use,   quick, trustworthy, and affordable tools  with…

Q: Eukaryotic cells can be detected at latest mid-way through the Proterozoic, and multicellular…

A: Eukaryotic cells evolved from the engulment of a prokaryotic cell by a large eukaryotic cell. Both…

Q: QUESTION 5 If a cell goes through anaerobic respiration, the cell may produce all the folliwing…

A: Introduction  Anaerobic respiration is a type of cellular respiration that occurs in the absence of…

Q: 5 Contrast the processes of binary fission and conjugation in ciliates

A: Binary fission and conjugation are two reproductive processes used by ciliates. Both of these…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: 4. Using the bicarbonate buffer system as an example, explain how buffers work

A: Buffer is a solution usually made up of weak acid and its conjugate base or a weak base and its…

Q: for a 5:1 insert: vector ligation reaction, including the volumes of insert and vector you…

A: Introduction: DNA is a long polymer made up of repeating units called nucleotides. It is the primary…

Q: An ecosystem engineer is an organism that is able to change, sustain, and develop new habitats.…

A: Any species that creates, drastically alters, preserves, or eliminates a habitat is considered an…

Q: A gamete cell has 4 picograms of DNA. How much DNA would be found in a 2n somatic (body) cell from…

A: Gametes are produced from reproductive cells by means of meiosis. A diploid parent cell produces…

Q: What is the function of the chemical tar?

A: Tar: Through destructive distillation, tar is a viscous liquid made up of free carbon and…

Q: Explain the uses for the different media types used to subculture media: Broth: Deeps: Slants:

A: ANSWER) Different culture medias are used to grow the bacteria in the particular medium. Broth,…

Q: What are the types of stimuli can be used in stimulating tissue * Name and define the types of…

A: Introduction  Tissue is a group of similar cells and their extracellular matrix (ECM) that perform…

Q: What kind of exudates do you expect to find in the soil?   What does phytoremediation mean in this…

A: There are two major types of riot exudates found in soil. [1] Low molecular weight compound (LMWC)…

Q: Which of the following is incorrect about short chain fatty acids produced by commensal bacteria?…

A: The term "short-chain fatty acids" (SCFAs) refers to a class of fatty acids that are distinguished…

Q: 11. An A-T base pair consists of a) 1; 2 b) 2; 2 c) 3; 2 d) 2; 3 H-bond(s); a C-G base pair consists…

A: Amino acids are the building blocks of proteins. They are organic compounds that contain an amino…

Q: How does ampicillin kill nonresistant cells?

A: Ampicillin is an antibiotic derived from penicillin and is very effective in killing gram-positive…

Q: what is not true about hybrids between polar bears and grizzly bears in the wild (select all that…

A: Introduction :- Hybrids refer to offspring produced from mating between two different species or…

Q: Semitendinosus Gracilis Put the right muscle name in the right box. Infraspinatus Teres Minor Tensor…

A: The musculoskeletal system in humans is a complex system of bones, joints, muscles, tendons, and…

Q: Where do xylem and phloem rays each orginate from?

A: Introduction :- Xylem is a complex tissue responsible for the transport of water and dissolved…

Q: Sarah loves whole grains. Suppose she makes herself a snack from one serving of grains and one cup…

A: Introduction :- Proteins are large, complex molecules that play many important roles in the body.…

Q: Which of the following are true regarding assay attributes? List all that are true. a) Accuracy…

A: Assays are widely used in biological and medical research to measure the concentration of biological…

Q: there adequate evidence that drug addiction is a brain disorder

A: Drug addiction is a chronic condition in which a person is unable to say no to a particular drug in…

Q: lease and thank you take your time. Ive read the guide lines and honor code that i can have up to…

A: Introduction:  Minerals are naturally occurring, inorganic substances that have a specific chemical…

Q: Which provides evidence for evolution (select the best possible answer out of all obtiene  A.…

A: Evolution:  Evolution is the shift in a biological population's heritable traits over successive…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: