Q: a. Why are cells different from each other? b. How is a gene organized? (promoter, cis regulatory…
A: A cell is a fundamental unit of life. It is covered by the cell membrane and contains different…
Q: Define origin-recognition complex (ORC)
A: The field of biology that studies the composition, and structure of the molecules and also the…
Q: Consider the microarray in Figure 20.12. If a sample from normal tissue is labeled with a green…
A: Introduction Gene are the key component of genetic material which control almost all the cellular…
Q: Briefly describe a summary of the flow of genetic information in cells with diagram.
A: Gene expression is that the method the cell uses to provide the molecule it desires by reading the…
Q: Define Crygc gene.
A: CryGC or crystalline Gamma C gene is a protein-coding gene belonging to the beta/gamma crystalline…
Q: CAT: Use your translated amino acid sequences to determine the phenotypes to include in your…
A: DNA is a genetic material which carry information from one generation to next in the form of genetic…
Q: Choose the model that correctly shows the regulatory relationships between the nanos, bicoid,…
A: Gene regulation is the process of regulation of expression of a gene. It means to regulate the…
Q: B. Does evervone have a copy of this gene? Explain vour answer.
A: Only b part of the question has been asked which is explained in the following step. APP: It is the…
Q: Describe the mechanisms by which gene regulation is controlled by changes in the concentration of…
A: Autoinducers are small molecule (Low Molecular weight) proteins readily diffusible through the…
Q: Defi ne palindrome and draw three different palindromic sequences.
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Differentiate between gene expression inheterochromatic and euchromatic regions
A: Gene expression involves the flow of information to form the target protein. It is the process that…
Q: Meta analysis C9orf72 Known Novel • 20 15 10 SARM1UNC13A МОВР GPX3-TNIP1 -LOC101927815- SCFD1- 5 CO…
A: ALS (Amyotrophic Lateral Sclerosis) is a group of rare neurological disease. It involves the motor…
Q: Determine the 17 b p primers that can be used to locate the gene into which the transposon is…
A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…
Q: Given a mutation in the promoter, coding region, and/or non-coding region of a gene, explain how…
A: The mutation is a sudden heritable change in the genetic makeup of a cell which mostly results in…
Q: describe two blotting methods (i.e., Northern blottingand Western blotting) used to detect gene…
A: Northern blotting The northern blotting is a molecular biology technique used to study gene…
Q: describe the main steps required to clone a gene and produce a protein.
A: Gene cloning is the technique of locating and copying (cloning) a gene of interest from all the DNA…
Q: Identify the promoter in the diagram shown below. 1 2 3 4 7 8 4 6. 7 1 00
A: The promoter serves as a binding site for RNA polymerase, the transcription enzyme. The lac…
Q: ) Consider a reference genome with genes as follows: AGAGAGAG|AACAACAACAAC|GGGAAAGGGAAA gene 1 |…
A: In DNA sequencing, a read is considered as an inferred sequence of base pairs or base pair…
Q: Explain the expression vectors ?
A: Introduction A vector is a DNA molecule that is used in molecular cloning to intentionally transport…
Q: 2a) With the aid of diagrams, describe the critical role of restriction enzymes in genetic…
A: Genetic Engineering is combining DNA from two or more different organisms to create recombinant DNA.
Q: Explain the following term: Gene:
A: Genes are found on chromosomes, which are small spaghetti-like structures.
Q: Identify the labeled factors in the figure below (A and B) and indicate the direction of…
A: Hi dear, here's your answer.can you please give me an upvote. TBP and TFIIB bind and form stable…
Q: Where is the promoter ? 2 5. 6. Select an answer and submit. For keyboard navigation, use the…
A: Promoter is a region the DNA sequence where the transcription is initiated.
Q: explain Mapping of genes by generalized transduction
A: The mapping and the linkage of genes of the bacterial chromosomes are studied with the help of…
Q: explain Mapping genes by cotransductionfrequencies.
A: Transduction is the process of genetic recombination when a virus acts as a vector for delivering…
Q: Table I CAC GTA GACTGAGG ACTC CACGTA GACTGAGG ACAC Wild-type beta-globin gene fragment Sickle-cell…
A: Abrupt changes in the DNA sequence of nucleotides is called mutation. Even a single nucleotide…
Q: Discuss what message does a gene provide? How is the language of the gene expressed?
A: The simplest physical and functional unit of heredity can be defined as a gene. DNA is what makes…
Q: a- What is genome assembly?
A: Sequence assembly is the process of matching & combining segments from a larger DNA sequence in…
Q: Diagram a gene that is affected by CRE andCREB, showing which proteins and nucleic acids contact…
A: The specific transcription factor CREB binds to the CRE. When CREB is phosphorylated it also binds…
Q: Discuss in your own wordings the concept of gene expression. proper explanation and diagram
A: The genetic material present in the nucleus stores the genetic information that is expressed in the…
Q: Please draw a diagram to show the genomic organization of a gene with three exons
A: mRNA is the transcript that is finally used as the template for protein synthesis.
Q: Discuss the arrangement of genes in genomes,including the number of genes, transcription…
A: Human Genome Project is a worldwide effort that was aimed at sequencing all 3.2 billion base pairs…
Q: Discuss the difference between the terms gene, transcription unit, locus and allele
A: In genetics several glossaries are used to indicate different terms and processes. Because the…
Q: Do the same mechanisms that govern gene expression operate in bacterial cells and eukaryotic cells?…
A: The central dogma of molecular biology was given by Crick to explain the flow of genetic information…
Q: Draw a simplified schematic for Heidelberg screening to identify zygotic genes.
A: Zygotic mutants P z/+ ♀ x z/+♂ F1 z/z z/+ z/+ +/+
Q: Describe CRISPR/Cas9 and how it is used to modifygenomes.
A: CRISPR/Cas9: CRISPR technology is a simple yet powerful tool for editing genomes. It allows…
Q: Define copy number variants (CNVs)
A: The chromosomal alteration could be the structural or numerical abnormalities that exist in an…
Q: Illustrate the set of primers specific for the gene of interest ?
A: Gene specific primers bind to the DNA inside the cell, while vector specific primers attach to the…
Q: In cancerous cells, CpG islands are: where intercalating agents are found demethylated…
A: CpG stands for 5'—C—phosphate—G—3', which means that cytosine and guanine are separated by just one…
Q: What gene expression question could you answer using data from the ENCODE website
A: Gene expression includes the synthesis of an RNA transcript from a DNA template and translation of…
Q: s the process to multiply the number of a target ge
A: The target DNA sequence is a particular sequence made up primarily of the nucleotides adenine,…
Q: define Bar gene
A: Gene is the hereditary unit of an organism which can be inherited from parent to the offspring. This…
Q: Describe three features that control whether gene is transcribed.
A: Gene expression is initially regulated by controlling the mRNA sequences that is produced from a…
Q: Which column below accurately describes which components of the gene are translated by ribosomal…
A: The process of translation takes place in a structure known as the ribosome. The ribosome is divided…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Give a schematic diagram of how gene therapy works for the treatment of genetic disorders? Please answer at your own words.Give examples of effective and ineffective gene therapy. Describe each and discuss in 150 words.Diagram a gene that is affected by CRE andCREB, showing which proteins and nucleic acids contact each other.
- Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’Give a schematic diagram of how we can Treatment Thalassemia by using gene therapy? Please answer at your own words,please..Discuss which barcodes to use for bacteria, animals, plants and fungi and why with references (1000 words)