C programming In this task you are required implement a function that counts the number of alphabetical characters in a string. The function declaration is int count_isalpha(const char *str);. argument str is a constant string that will be processed to find the number of alphabetical characters. It returns the number alphabetical characters before the termination character

C programming In this task you are required implement a function that counts the number of alphabetical characters in a string. The function declaration is int count_isalpha(const char *str);. argument str is a constant string that will be processed to find the number of alphabetical characters. It returns the number alphabetical characters before the termination character

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter6: User-defined Functions

Section: Chapter Questions

Problem 23PE

See similar textbooks

Similar questions

C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…
Computer Science ****Please Write a program CODE in C 2. Write a function which takes a string of any length and returns the number of times the letter a appears in the string. Write the main program, which prompts the user to enter a sentence (up to 100 characters) and uses the function to find the number of times a occurs in the sentence. Print the result.
C code blocks Implement a function which receives a character array and determines if the word is a palindrome or not. A palindrome is a string that is spelt the same way forwards and backwards (see the example below). The function should return 1 if the character array is a palindrome and 0 if it is not. Write the entire function in the space below. Your answer should not include the function prototype, the main function or any include statements. The function should not contain any printf statements. Define your function in the same way as the given function prototype. Function prototype: int palindrome(char a[]); For example: Input Result hello 0 radar 1 acca 1
Python task You must write a function control (p_nr) that calculates and returns the control digit in a 10-digit social security number if you send in the first 9 digits in the form of a string. The rules for calculating the check digit in a social security number are as follows:The numbers are multiplied alternately by 2 and 1 and then the products are summed. For a two-digit product, the sum of its numbers is calculated. The sum is then subtracted from the nearest higher tens to obtain the check digit.To calculate the check digit for the social security number with the first 9 digits 811218987, perform the following setup: 8 1 1 2 1 8 9 8 7 2 1 2 1 2 1 2 1 2 16 1 2 2 2 8 18 8 141 + 6 + 1 + 2 + 2 + 2 + 8 + 1 + 8 + 8 + 1 + 4 = 44The check digit is 50-44 = 6 # test personal_number = input () control_digit = control(personal_number) print(control_digit)
String Manipulation In this question, you will be implementing the following functions int findChar(char * str, char c); Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1 int replaceChar(char * str, char c1, char c2); Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0. int removeChar(char * str1, char * str2, char c); Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’ For example, if str1=”Hello World” and c=’l’ then the function should make str2=”He**o Wor*d” int isPalindrome(char * str) Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc. int reverseString(char…
C++ Create a function print_double_spaced(cs) that takes a C string as an argument and prints the characters of that string separated by a space. For example, the string hello world should be printed as h e l l o w o r l d
Create a function called reverse() that has a string parameter. The function reverses the characters of the string locally. ( in C language)
C Programming Language Write a function that takes 2 strings, word1 and word2 as parameters. The function must return if,starting from word1, by only deleting some characters you can get word2.Example: word1: pineapple and word2:nap result: true; word1: orange, word2: one; results: true;word1: cyberspace; word2: peace, result: false
IN C PROGRAMMING LANGUAGE PLEASE AND COMMENT EVERY LINE PLEASE SO I CAN UNDERSTAND Write your own code in the form of a function that split a string of words separated by spaces into these words. The program should print each word per a new line.
in c programing with User-Defined Functions Remove all non-alphabetic characters Write a program that removes all non-alphabetic characters from the given input. Assume the input string will not exceed 50 characters. Ex: If the input is: -Hello, 1 world$! the output is: Helloworld The program must define and call a function named RemoveNonAlpha that takes two strings as parameters: userString and userStringAlphaOnly. userString is the user specified string from the program input. Function RemoveNonAlpha() then assigns userStringAlphaOnly with the user specified string without any non-alphabetic characters.void RemoveNonAlpha(char userString[], char userStringAlphaOnly[])
8.10 (Appending Part of a String) Write a program that uses function strncat to append part of a string to another string. The program should input the strings, and the number of characters to be appended, then display the first string and its length after the second string was appended. **Note solve question without using pointers in c language
In C++, Write a function that receives a string of characters and return true if the string is in language, otherwise it returns false. You may use following function header (Assume a string is in language if it is read from the left side is the same as it is read from the right side. For example, a-b-d-c is not in the language, a-b-c-a-c-b-a is in language): bool isInLanguage_2(string aString) And I also, want to know if my if statement is incorrect, and if it is how is it incorrect?