Characterize the following human chromosomes as to size and as to position ofits centromere.SizeType as to position of its centromereChromosomeIn Group C18in Group GY Chromosome Characterize the following human chromosomes as to size and as to position ofits centromere.4.ChromosomeSizeType as to position of itscentromere# 1In Group C# 18In Group G78LABORATORY EXERCISESIN GENETICSY chromosome

Chromosomes are thin, small thread-like structures that have both short and long arms separated by…

Answered: Characterize the following human…

Characterize the following human chromosomes as to size and as to position of 4. its centromere. Chromosome Size Type as to position of its centromere In Group C #18 In Group G

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 3QP: A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13....

See similar textbooks

Related questions

Q: I. Give the chromosome number and chromosome configuration if the following mutations occurred in…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: Which of the following describes a human cell that contains 47 chromosomes, which includes one pair…

A: Normal chromosome number in a cell is 47 that is there are 23 pairs of chromosomes out of which…

Q: The STR DNA marker DS11 is located on the p arm of the chromosome #8 in humans. Molecular analysis…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Tabulate the different classifications of Human chromosomes. Group them as well using "Vogel and…

A: Chromosomes are ds and are the carriers of genes. They can control cellular metabolism, heredity and…

Q: Diploid Number of chromosomes, Sex Chromosomes, (+/- whole) Chromosome (+/- partial) e.g. 47, XY,…

A: Human cell contains 23 pairs of chromosomes. 22 autosomes and 1 pair of sex chromosomes. Human male…

Q: What is the specific base sequence found in human telomeres, and how does the base sequence…

A: The physical end of the chromosomal is known as Telomere. It protects the chromosome's ends from DNA…

Q: Which of the following is characteristics of an acrocentric chromosome? 1.centromere is closer to…

A: DNA contains inheritable segments that are called genes that contain instructions for protein…

Q: Determine the correct order of the genes on the chromosome, given the following information: Genes A…

A: During crossing over, part of one chromosome is exchanged with another. The result is a hybrid…

Q: In which of the following ways do polytene chromosomes differ from other chromosomes? Polytene…

Q: the chromosomes of a yellow fever mosquito (Aedes aegypti). The species has 6 chromosome number…

A: Yellow fever organisms can grow in empty flowerpots, polluted swimming pools, spare tires, and…

Q: Consider the following DNA molecule (shown in the picture) and assume this is the DNA sequence of…

A: Amino acid sequence formed from the 5'to 3' end is tta atc gtc tac gta cta cgt taa tga tcg…

Q: a. List three (3) features to identify the structure of a chromosome. b. Based on the three…

A: Introduction :- Chromosomes are the greatest level of DNA and protein organisation. Chromosomes'…

Q: Tabulate the different classifications of Human chromosomes. Group them as well using "Vogel and…

A: Humans have 46 chromosomes arranged in 23 pairs, among which 22 pairs are autosomes while the 23rd…

Q: Which of the following is false regarding Down Syndrome? O can be caused by a Robertsonian…

A: The thread like structures seen inside the nucleus of every cells are called chromosomes. These are…

Q: The STR DNA marker DS11 is located on the p arm of the chromosome #8 in humans. Molecular analysis…

A: data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAbQAAAExCAYAAAAUSVctAAAAAXNSR0IArs4c6QAAIABJREFUeF7snQ…

Q: What do you call a chromosome where its centromere is 3/4 from the end of the chromosome

A: Chromosomes are found in nucleus of cells and consist of DNA tightly bound into thread like…

Q: Human chromosome 11 GC content is 42%. What is the percentage of each nucleotide on chromosome 11?

A: According to Chargaff rule,- in DNA there is always equality in quantity between the bases A and T…

Q: When analyzing a normal human male karyotype, all of the chromosomes can be sorted into homologous…

A: Genetics is a study of genes, heredity, and genetic variation in an organism. Living organisms…

Q: Metacentric chromosomes have a centromere located: A. near the middle of the chromosome…

A: The centromere is the specialized DNA sequence of a chromosome that links a pair of sister…

Q: What is the notation for the following cases? ( A female having Edwards syndrome (trisomy 18)

A: The chromosomal syndrome notation includes the total number of chromosomes, then the sex chromosome,…

Q: Which of the following describes the relationship between these three genes? > View Available…

A: In sexual reproduction, during the meiosis phase, DNA sequences that are near together on a…

Q: A young couple is planning to have children. Knowing that there have been a substantial number of…

A: Robertsonian translocation is a kind of chromosomal abnormality in which two acrocentric chromosomes…

Q: Diploid Number of chromosomes, Sex Chromosomes, (+/- whole) Chromosome (+/- partial) e.g. 47, XY,…

A: Klinefelter’s syndrome and one Barr body Klinefelter’s syndrome is due to the trisomy of sex…

Q: The discovery of chromosome banding in eukaryotes has greatly improved our ability to distinguish…

A: Polymorphism is usually known as the discontinuous genetic diversity that occurs among members of a…

Q: A male Drosophila from a wild-type stock is discovered to have only seven chromosomes, whereas…

A: As mentioned the chromosome IV is attached to the distal end (which is farther from the centromere…

Q: Barr Bodies, Sex Chromosomes and Diploid Number Number of Barr Bodies Phenotypic Sex of Individual…

A: BARR BODY It is an inactivated, condensed X chromosome found in female cells. Barr bodies are…

Q: The centromeric position of a chromosome can be represented by centromeric index (CI), which is…

A: The chromosome is the condensed form of DNA that contains all the genes. The chromosome is composed…

Q: approximate and base pairs) between the largest and s

A: Chromosome- A structure found inside the nucleus of a cell is refers as the chromosome. It is made…

Q: Diploid Number of chromosomes, Sex Chromosomes, (+/- whole) Chromosome (+/- partial) e.g. 47, XY,…

A: Aneuploidy is a condition of having fewer or extra chromosomes than the normal genome number of the…

Q: Shown below is a partial gene map for Drosophila melanogaster. In Drosophila, vermillion e are…

A: The genetic cross are monohybrid and dihybrid cross. The monohybrid cross results in a phenotypic…

Q: Chromosome Pairs 1-22 are considered what type of chromosomes?

A: Chromosomes are filamentous bodies present in the nucleus. They are composed of DNA(…

Q: 47 The arrows indicate the products of a reciprocal translocation between chromosomes 9 and 22.…

A: The abnormal chromosome 22 shown in this figure is philadelphia chromosome. It is formed when a part…

Q: Corn has a chromosome number of 2=20. Supposing there are different aneuploidy/polyploidy in corn,…

A: The sex chromosomes decide an individual's sex. The majority of people have two sex chromosomes, one…

Q: The size of one copy of the human genome is approximately 3 billion base pairs, and it contains…

A: A gene is the fundamental physical and functional unit of heredity. These are comprised of DNA. A…

Q: The STR DNA marker DS11 is located on the p arm of the chromosome #8 in humans. Molecular analysis…

A: A pattern of two or more nucleotides repeated next to each other is known as a short tandem repeat…

Q: Diploid Number of chromosomes, Sex Chromosomes, (+/- whole) Chromosome (+/- partial) e.g. 47, XY,…

A: Down syndrome is a genetic disorder that generally associated with the physical growth delays,…

Q: Most body (nonreproductive) cells of humans and other multicellular eukaryotes have two sets of each…

A: Introduction : "Mitosis Is The Process In Which Newly Generated DNA Is Separated And Two New Cells…

Q: The following corn loci are on one arm of chromosome9 in the order indicated (the distances between…

A: Introduction A phenotype is a set of observable characteristics about an individual, such as height,…

Q: 3) Fruit flies are commonly used by scientists studying DNA. They have a diploid number of 8 total…

A: Meiosis cell division leads to increase genetic diversity since, during meiosis, the diploid cell…

Q: how does the base sequence contained in the telomeric regions of chromosomes differ from that found…

A: Telomere Telomere is a special structure having unique DNA which is located on the end of each…

Q: The Pipsy (P) gene can be found on chromosome 6 alongside 3 other genes D, G and T. Based on the…

A: The genes are found on different chromosomes, occasionally far apart, but on the same chromosome,…

Q: Chromosome number per pole: 4 chromosomes in the left pole and 4 chromosomes in the right po…

A: Anaphase : It is the fourth phase of mitosis , the process that separates the duplicated genetic…

Q: Pea plants have seven different types of chromosomes. A chromosome with a centromere at the very end…

A: Chromosomes are divided into two parts (p and q arms) with a constriction point called a centromere…

Q: A B C F G H E Chromosome 1 N P Q R S KL M Chromosome 2 10. The image above shows two normal…

A: Chromosomal abnormalities refer to changes in chromosomal number (numerical abnormality) or…

Q: Human sperm or egg cells contain one set of chromosomes which is a configuration known as __________…

A: Introduction :- Sperm cells are gametes (sex cells) produced by male humans and animals in the…

Q: Including the sex chromosomes, the chromosome number of a normal human cell is ___________ and the…

A: Chromosomes are present inside the cell nucleus and made up of DNA (Deoxyribonucleic acid) molecules…

Q: Haploid vs. Diploid Numbers Fill in the missing items on the table Total # of # chromosomes in #…

A: Chromosome number, precise number of chromosomes typical for a given species. In any given asexually…

Q: (a) A person with Down syndrome. She has 47 chromosomes rather than the common number of 46, because…

A: Chromosomes are the thread-like structures that appear during cell division due to the condensation…

Question

100%

Characterize the following human chromosomes as to size and as to position of its centromere. Size Type as to position of its centromere Chromosome In Group C 18 in Group G Y Chromosome

Characterize the following human chromosomes as to size and as to position of
its centromere.
4.
Chromosome
Size
Type as to position of its
centromere
# 1
In Group C
# 18
In Group G
78
LABORATORY EXERCISESIN GENETICS
Y chromosome

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

In which of the following is genetic material moved betweennonhomologous chromosomes?a. insertion d. translocationb. nondisjunction e. inversionc. deletion
Characterize the following human chromosomes as to size and as to position of its centromere.
With regard to the analysis of chromosome structure, explain theexperimental advantage that polytene chromosomes offer. Discusswhy changes in chromosome structure are more easily detected inpolytene chromosomes than in ordinary chromosomes.
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
How many Barr bodies would you expect to see in a human cellcontaining the following chromosomes? a.XY
How many Barr bodies would you expect to see in a human cellcontaining the following chromosomes? a. XYY b. XXX c. XXXX
A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13. In discussing this discovery with a friend who is not a cytogeneticist, explain how you would describe this location, defining each term in the chromosome address 21q13.
For each of the terms in the left column, choose thebest matching phrase in the right column.a. reciprocal translocation 1. lacking one or morechromosomes or having oneor more extra chromosomesb. gynandromorph 2. movement of short DNAelementsc. pericentric 3. having more than two completesets of chromosomesd. paracentric 4. exact exchange of parts of twononhomologous chromosomese. euploids 5. excluding the centromeref. polyploidy 6. including the centromereg. transposition 7. having complete sets ofchromosomesh. aneuploids 8. mosaic combination of maleand female tissue
You are given a metaphase chromosome preparation (a slide)from an unknown organism that contains 12 chromosomes.Two that are clearly smaller than the rest appear identical inlength and centromere placement. Describe all that you canabout these chromosomes.
Morphology of Chromosomes can bebest studied at ______A. Interphase B. ProphseC. Metaphase D. Zygotene
How many Barr bodies would you expect to see in a human cellcontaining the following chromosomes? a.XXY
Which of the following terms should not be used to describe aBarr body?A. ChromatinB. EuchromatinC. HeterochromatinD. ChromosomeE. Genome