Choose the item in column 2 that best matches each item in column 1. A. Provides information for production of protein B. Binds to promoter C. Promoter has a box A and box B consensus sequences D. Autocatalytic RNA molecules E. Associated with transcription termination F. Polymerization of ribonucleotides to form RNA molecules G. 7-methyl guanosine H. MRNA prior to processing select - 1. Core RNA polymerase select 2. rho (p) factor select 3. hnRNA select - 4. RNA select -5. RNA polymerase holoenzyme select 6. Ribozymes select - 7. 5' MRNA cap select 8. MRNA

Choose the item in column 2 that best matches each item in column 1. A. Provides information for production of protein B. Binds to promoter C. Promoter has a box A and box B consensus sequences D. Autocatalytic RNA molecules E. Associated with transcription termination F. Polymerization of ribonucleotides to form RNA molecules G. 7-methyl guanosine H. MRNA prior to processing select - 1. Core RNA polymerase select 2. rho (p) factor select 3. hnRNA select - 4. RNA select -5. RNA polymerase holoenzyme select 6. Ribozymes select - 7. 5' MRNA cap select 8. MRNA

Name: Choose the item in column 2 that best matches each item in column 1.A
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Choose the item in column 2 that best matches each item in column 1.A. Provides information for production of proteinB. Binds to promoterC. Promoter has a box A and box B consensus sequencesD. Autocatalytic RNA moleculesE. Associated with transcript

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 6TYU

See similar textbooks

Similar questions

The promoter and terminator regions of genes are important in: a. coding for amino acids b. gene regulation c. structural support for the gene d. intron removal e. anticodon recognition
Which of the following statements best describes the promoter of a protein-coding gene? A. The promoter is a protein that recruits RNA polymerase. B. The promoter is part of the RNA molecule itself. C. The promoter is a site found on RNA polymerase. D. The promoter contains the AUG start codon. E. The promoter is a nontranscribed region of a gene.
Which of the following are steps of transcription? Select all that apply. A. RNA polymerase binds to a gene’s promoter. B. RNA polymerase moves over the gene and unzips the double helix to form a “transcription bubble.” C. RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA. D. RNA polymerase assembles a strand of mRNA complementary to the noncoding strand of DNA.
The sigma subunit of bacterial RNA polymerase _____. a. binds to a bacterial gene’s promoter b. is composed of both polypeptide and RNA molecules c. is required for termination of transcription d. is required for RNA polymerization e. is required for ribosomal binding
Which of the following statements is/are TRUE for transcription? A. RNA polymerase uses one strand of DNA, the antisense strand, for RNA synthesis. B. The first ribonucleotide binds to the Pribnow region. C. RNA polymerase moves from 5’ → 3’, while the RNA polymerization is from 3’ → 5’. D. All four ribonucleoside monophosphates are required.
Which of the following are steps of transcription? Select all that apply. a.RNA polymerase assembles a strand of mRNA complementary to the noncoding strand of DNA. b.RNA polymerase binds to a gene’s promoter. c.RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA. d.RNA polymerase moves over the gene and unzips the double helix to form a “transcription bubble.”
Which of the following makes alternative RNA splicing possible? Group of answer choices A. Parts of a gene can function as exons or introns B. DNA methylation C. Parts of a gene can be either transcribed or not D. Histone Acetylation E. Parts of a gene can bind to RNA polymerase or not
Which of the following plays a major part in determining whether or not RNA polymerase will transcribe a parti sequence? Select all that apply. A. A ribosome is already bonded to the gene sequence B. A complete set of transcription factors bind to DNA associated with that gene C. The chromatin structure is loosened in the region of that gene D. RNA polymerase binds to the promoter of that gene ..
A person’s 5’ capping machinery has failed, but the PolyA tail machinery is still working. Pretending that they actually survive this issue, which of the following is a possible consequence? The person acquires many somatic mutations. The person has higher than normal levels of mRNA in the nucleus. The person has dTTP bases in the mRNA instead of UTP. The person develops a fever and body aches. If not higher than normal levels of mRNA in the nucleus, would it be fever and body aches due to the immune system being launched because mRNA cannot recognize self?
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA template
Which of the following is not a reason that gene transcription is selective (occurs on specific segments of DNA)?Group of answer choices a) in eukaryotes, transcribed mRNA is processed to add a poly-A tail b) sigma factors direct RNA polymerase where to bind the DNA template c) promoters differ from gene to gene