Q: The reason why lions do not develop scurvy without eating vegetable is that lions eat herbivore…
A: Scurvy is a disease carried on by a lack of vitamin C. (ascorbic acid). Early indications of a…
Q: P is a dominant allele for pu following cross is performed flowers? In peas, T (tall) is dominant…
A: In a genetic cross, two different individuals are crossed or mated to produce off-springs that…
Q: Which two fluorescence-based methods allow localization of proteins in vivo?
A: There are a number of advance microscopy techniques that help in understanding living cells.…
Q: what is Taxol ? What does it Target in cancer cells ? (relate it to cell communication and cell…
A: Introduction : The term "cancer" refers to disorders in which abnormal cells proliferate…
Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
A: The initial stage of gene expression, transcription, uses information from a gene to build a…
Q: Elaborate stages of female sexual response.?
A: A series of emotional and physical changes that occur in the female when she becomes sexually…
Q: C. SLIDE: Ranunculus mature root xs (Text p. 566) 1. Draw and label: epidermis, cortex, vascular…
A: The Ranunculus belongs to the family Ranunculaceae and is a member of flowering plants. The mature…
Q: Compare and contrast drugs used in treament of heart failure. Provide mehcnaims. 650 words
A: Heart failure is the condition in which the heart fails to pump blood to the body. Common symptoms…
Q: You can carry out matings between an Hfr and F strain by mixing the two cell types in a small patch…
A: In the mating experiment, the Hfr bacterial strains frequently yield chromosomal gene recombinants.…
Q: Are there any differences in morphology between monocot and dicot fruits? Tabulate these differences…
A: Morphology means the angiosperm show such a large diversity in external structure like it's all…
Q: Provide the type of exercise of the given body part. Identify it is AEROBIC, MUSCULAR OR FLEXIBILITY…
A: Aerobic exercise : Aerobic exercise is a physical exercise of low to high intensity that depends…
Q: When a person receives a vaccination, it is considered passive and artificial passive and natural…
A: Introduction Vaccination is a process by which a person becomes protected against a particular…
Q: What mutations would have the greatest effect on peptide sequence? Which would have the least…
A: Introduction A mutation is a rapid, heritable alteration in an individual's phenotype. A mutation is…
Q: By the time this book is published, it will likely be possible for you to obtain the sequence of…
A: Introduction It has become easy to know about the genome of the body by the help of advanced…
Q: Describe one advantage and one disadvantage of ASEXUAL reproduction.
A: Paramecium, sometimes known as Paramoecium, is a genus of "ciliated unicellular protozoa." They live…
Q: CLASS AMPHIBIA-SALAMANDERS, FROGS, & TOADS The hind limbs of the frog are much longer than the…
A: A frog is a tailless, short-bodied amphibian belonging to the big carnivorous group of species. A…
Q: How can a scientist determine whether a protein with a common origin in bacteria and a fruit fly…
A: Introduction: Generally, proteins with similar sequences perform similarly. The same origin or…
Q: 26. Fill in this summary table to compare and contrast types of transport. For secondary you need to…
A: Simple diffusion is a diffusion in which substance will moves from higher to lower concentration. It…
Q: Why do microorganisms differ in their pH requirements for growth?
A: Microorganisms It is a microscopic organism that can exist as a colony of cells or as a single cell.…
Q: What cell component carries out translation?
A: Translation is synthesis of proteins in a specific amino acid sequence from mRNA. It begins with the…
Q: Suppose you wanted to study genes controlling the structure of bacterial cell surfaces. You decide…
A: To study the genes controlling the structure of bacterial cell surfaces, an individual decides to…
Q: Affinity and specificity of protein-protein interactions are mainly mediated by many weak chemical…
A: PPIs have been investigated using a variety of techniques and viewpoints, including biochemistry,…
Q: Diagram on how to make a cancer vaccine.
A:
Q: Based on this ASO test, which patient(s) definitely have CF? Patient 1,2,3 or 4? Based on this ASO…
A: Cystic fibrosis is a genetic disease that can be fatal. It causes the build-up of abnormally thick…
Q: What are the main organs of the endocrine system and the functions of each organ
A: The endocrine system is a complex system that contains several glands and organs those plays an…
Q: Cancer cells can secrete factors which promote the formation of new blood vessels. The formation of…
A: Cancer is a condition in which the cells divide in an uncontrolled manner and spread to different…
Q: Every single cell in your body contains the same genetic information. Determining right and wrong
A: Every cell contributes to the organism's overall functioning. Cells are designed to execute certain…
Q: The process of crossing-over occurs during Prophase I of meiosis Prophase II of meiosis…
A: First question Meiosis is the type of cell division in which a diploid mother cell divides to form…
Q: Transfer RNAs (tRNAs) serve as adaptors between mRNA and amino acids during protein synthesis.…
A: tRNAs and mRNA both plays a crucial role in protein synthesis they interpret and transfer genetic…
Q: Identify the fungus picture below by common name
A: In the same kingdom as plants, vertebrates, parasites, and monera, fungi are a form of eukaryotic…
Q: Early classification systems from Aristotle to Linneaus would have been most like what we now call…
A: The earliest system of classification were based on easily observable characteristics which are…
Q: If I have been exposed to an infectious microbe for the second time, which of the following…
A: Immunoglobins or Ig are released by the B-lymphocytes or B-cells and responsible for binding with…
Q: The correct description of altruism by kin selection is that O An individual helps because all of…
A: The coefficient of relatedness (r) is a measure of how related two individuals are. It is usually…
Q: Piebald spotting is a condition found in humans in which there are patches of skin that lack…
A: A person's physical and physiological features are all passed down to them through their genes,…
Q: Which method of medical imaging involves annihilation?
A: Introduction Radiology is the medical discipline which uses the medical imaging to diagnose diseases…
Q: Orrorin tugenesis may be the earliest hominin because it has a thigh bone that the discoverers say…
A: Orrorin tugenensis, who lived around 6 million years ago, is one of the oldest early humans on our…
Q: Humans have 46 chromosomes in each somatic cell. a. How many chromosomes does a child receive from…
A: Introduction:The nucleus has chromosomes, which house the genetic material. Autosomes and sex…
Q: Explain how "protein homology" is related to "gene homology". (Hint: how does a protein sequence…
A: Proteins are made up of amino acids that are bounded together by peptide bonds. They are synthesized…
Q: What ethical issue do you think is the major problem the staff have in the laboratory?
A: Nowadays, ethical issues are present in all fields, including life sciences and medicine. Ethical…
Q: Consider a fish of a schooling species that has damage to its eyes (Fish X) compared to a fish of…
A: Fish schooling is defined as the movement of fish in a group. Fish schooling helps the fish in their…
Q: 43. What did the Meselson-Stahl experiment demonstrate? A. The conservative mechanism of DNA…
A: What does meselson and Stahl experiment demonstrate? Meselson and Stahl experimented using E. coli…
Q: Discuss and draw the Hodgkin–Huxley model of action potentials in neurons
A: Hodgkin and Huxley were the researchers who performed experiments in Axon of the Squid and found the…
Q: What is the strand of DNA that is transcribed called?
A: Nucleus is a chief controlling the cell which comprises of long thread like structure known as…
Q: W.Compared with 1990s, more people are killed by cancer in 2000s and in 2010s. Determining right…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: If the entire population were killed by disease and died off what will happen to the wolf population…
A: The extinction of majority of the population of the wolves may occur due to various reasons like…
Q: The X-linked gene responsible for DMD encodes a protein called dystrophin that is required for…
A: Introduction: Duchenne muscular dystrophy (DMD) is a genetic condition in which the muscles weaken…
Q: This gene is implicated in food preferences. search to determine what sorts of foods have their…
A: PTC is phenylthiocarbamide and it is the capacity to taste bitter substances, many of which are…
Q: In an ant colony in which the queen is mated with 2 males the average relatedness of a female worker…
A: The proportion of worker-produced males, the number of related queens, and the projected worker-male…
Q: In a monohybrid cross, what proportion of heterozygotes is expected among the offspring?
A: Ans : Monohybrid cross is the cross between two organisms of same species that differs in one trait…
Q: How does lungfish, amphibians, reptiles, and mammals in utero can each redirect blood flow to be…
A: Lungfish has lungs to breathe air. This is the unique feature in lungfish compared to other fish.…
Step by step
Solved in 2 steps
- Homologaus Chromasomes A= В. B = XX C = с. D = Centromere A. Sister Chromatids D. 7. Label the following terms/descriptions as either "Sister Chromatids", "Homologous Chromosomes," or "Both." (1 point each; 9 points total) a. Have identical DNA sequences b. Separate during meiosis c. Separate during mitosis d. Separate during meiosis I e. Separate during meiosis II f. One comes from the mother and the other from the father g. Are held together by cohesion h. Can undergo crossing over i. Are separated by the spindleIf a cell has five pairs of chromosomes, and if this cell undergoes cell division, the number of chromosomes found in anaphase I and anaphase II, along with the chromosome arrangement with respect to chromatids, are respectively. The statement given above is completed by the information in row and ii Rowi A. 10 chromosomes 10 chromosomes with single chromatid В. ii with linked sister chromatids 20 chromosomes 10 chromosomes with linked sister with single chromatids С. chromatid 10 chromosomes 20 chromosomes with single chromatid with single chromatid 10 chromosomes 10 chromosomes with linked sister with linked sister chromatids D. chromatidsA sexually reproducing organism has the following phenotype DdEeAaTt: The D and E loci are on the same arm of a metacentric chromosome in cis configuration. The A locus is on the long arm of an acrocentric chromosome and the T locus is on a telocentric chromosome. There are no other chromosomes. Using diagrams, show a cell at metaphase of mitosis and show the results of mitosis. Ensure you show the location of the gene loci on the different chromosomes.
- The figure above shows a metaphase in which one chromosome is only connected to the spindle by a single kinetochore, thus the sister chromatids may not separate correctly during anaphase. which of the following statement/s is/are correct;29) Anaphase Il is essentially the same as mitotic anaphase except that in anaphase II and in mitotic anaphase D) the cells are haploid and sister chromatids separate... the cells have the same number of chromosomes as the original cell and sister chromatids separate the cells are diploid... the cells are haploid chromosomes line up double file in the middle of the cell.. chromosomes line up single file in the middle of the cell crossing over occurs... crossing over does not occur the cells are haploid and sister chromatids separate... the cells have the same number of chromosomes as the original cell and sister chromatids separateA somatic cell has the genotype DdEe. All chromosomes in this organism are metacentric. Show metaphase and the results of mitosis if the D and E locus are linked on the same chromosome in trans configuration. A sexually reproducing organism has the following phenotype DdEeAaTt: The D and E loci are on the same arm of a metacentric chromosome in cis configuration. The A locus is on the long arm of an acrocentric chromosome and the T locus is on a telocentric chromosome. 2.1. What is the haploid number of this organism? 2.2. Using diagrams show a ceii at metaphase of mitosis and show the results of mitosis.
- The figure below shows a centrosome with microtubules attached to the kinetochore. Which of the following BEST describes the figure? O The figure shows an impossible arrangement due to microtubule dynamic instability. O The figure shows a temporary arrangement; soon after this, the microtubules will separate the sister chromatids. O The figure shows an impossible arrangement due to centrosome positioning. O The figure shows a temporary arrangement; soon after this, microtubule shortening will occur.The centromere Group of answer choices A is a group of proteins that attach to the kinetochore. B is not present on the chromosomes of the daughter cells until anaphase. C is a region of DNA where sister chromatids associate with one another and where the kinetochore forms D is a group of proteins that attach to the mitotic spindle. E is a region of DNA where sister chromatids associate with one anotherA sexually reproducing organism has the following phenotype DdEeAaTt: The D and E loci are on the same arm of a metacentric chromosome in cis configuration. The A locus is on the long arm of an acrocentric chromosome and the T locus is on a telocentric chromosome. There are no other chromosomes. 1. What is the haploid number of this organism? 2. Using diagrams, show a cell at metaphase of mitosis and show the results of mitosis. Ensure you show the location of the gene loci on the different chromosomes.
- 1. Ten centromeres are observed in a prophase cell from a Sorghum bicolor plant. a. How many pairs of chromosomes does this plant contain? b. For each stage of mitosis, indicate the number of centromeres you would expect to find and the number of copies of chromosomes attached to each centromere. Stage of mitosis: Number of centromeres visible cell Number of chromosomes per copies attached to centromere Prophase AnaphaseIdentify which of the following statements regarding anaphase is INCORRECT: Kinetochore microtubules are responsible for separating sister chromatids. O Interpolar microtubules are responsible for pushing the spindle poles apart. O Aster microtubules are responsible for pulling the spindle poles apart. Kinetochore microtubules shorten during anaphase A. O Interpolar microtubules shorten during anaphase B.Identify the correct features by dragging the labels/descriptions to their correct targets. A Bivalent (A) P1 M2 M1 P2 duplicated homologous chromosomes line up ind ndently at the metaphase plate (8) M1 P1 CH P2 M2 duplicated homologous chromosomes pair before lining up at the metaphase plate C B Sister chromatid Division that results in nonidentical daughter cells Division that results in identical daughter cells