Click on your screen over the DNA polymerase III enzyme depicted on the lagging strand. Replication fork (e) Synthesis of lagging strand Replication fork (c) Synthesis of lagging strand Submit response
Q: Distinguish between alternative complement pathway and Lectin pathway.
A: Introduction: Complement proteins: A system of plasma proteins that can be activated directly by pat...
Q: What is the BEST explanation for why DNA replication is discontinuous at the lagging strand? А. DNA ...
A: Replication process synthesizes DNA by the action of DNA polymerase enzyme.
Q: During “Chemical Evolution”, why are phospholipids important? a) They are living cells. b) They le...
A: ANSWER;-d) The Fatty Acid layer lets ionic molecules pass through. Explain;- These layers will allow...
Q: List down the similarities and differences present between a cnidarian medusoid and an adult ctenoph...
A: List down the similarities and differences present between a cnidarian medusoid and an adult ctenoph...
Q: A microbial geneticist isolates a new mutation in E. coliand wishes to map its chromosomal location....
A: A mutation is a sudden change in the DNA sequence. Mutations can result from mistakes during DNA cop...
Q: What colors (of the electromagnetic spectrum) are absorbed by plants? What would happen to photosynt...
A: Introduction In this question we will discuss about the impact on photosynthesis if the green light...
Q: What are twins? Genetically, what are the two types of twins that can occur?
A: Introduction In this question we have to define twins and have to discuss about the types of twins, ...
Q: On the lagging strand, the carbon in position on the deoxyribose sugar is facing the helicase enzyme...
A: *DNA replication occurs in semiconservative manner E * Each strand in the double helix of DNA acts...
Q: polymerase EXCEPT: / Almal geld vir DNA-polimerase, BEHALWE: A. generates dsDNA from SSDNA / generee...
A: DNA polymerase enzymes are important during replication. Their function is to add nucleotides to th...
Q: You co-culture the following bacterial strains: an Hfr prototroph and an F- auxotroph for the genes ...
A: During the process of interrupted mating (Hfr x F-), the transfer of genes to the F- strain is direc...
Q: The figures 1 and 2 show the agarose- gel electrophoresis pattern of the serum proteins of a healthy...
A: Serum Serum is the yellowish that is remains from blood plasma after the removal of clotting factor...
Q: Of the organs/tissues of the human body, glycolysis occurs mostly in the ____________ and ________...
A: Glycolysis is the breakdown of glucose into two three carbon compounds. Gluconeogenesis is the synth...
Q: How gene therapy treatment affect our future?
A: Gene therapy is the process of modifying genes in your body's cells to treat or prevent illness. You...
Q: Define the term ecosystem services. Give three examples of ecosystem services that people would have...
A: A dynamic community that contains a set of physical, chemical, and biological variables in a specifi...
Q: The climate has shifted, and it is much colder than it once was. Would your dragon be able ta surviv...
A: The dragon has a blue-colored body, without any polka dots, red ear frills, light blue wings, tan sp...
Q: Which of the following descriptions does not apply to a multicellular fungus? the mushroom is a tran...
A: *A fungus ia an eukaryotic organisms that contains microorganisms like yeasts and molds and some mu...
Q: In principle, RNAi may be used to fight viral infection. How mightthis work?
A: RNA interference is a post-transcriptional gene silencing mechanism that functions by silencing the ...
Q: What is known as Src phosphorylates ZBP1 ?
A: Introduction: The localization of beta-actin messenger RNA to the sites of active actin polymerizati...
Q: Why is it difficult to cure AIDS?
A: * Human immuno deficiency called HIV that attacks body immune system. *if HIV is not treated it can ...
Q: How are male gametophytes and male gametes formed in angiosperms?
A: Introduction In this question we will write how male and female gametes are formed in angiosperms.
Q: The regulation of mRNA decay relies heavily upon deadenylasesand decapping enzymes. Explain how thes...
A: These classes of enzymes are critical to initiating mRNA decay by decapping of the enzymes that are ...
Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are thes...
A: There are different forms of DNA found in a cell, these forms of DNA are required by the cell as eac...
Q: Human ribonucleotide reductase has two allosteric sites, the S site and the A site. What is the func...
A: Human ribonucleotide reductase in a mammalian enzyme that is responsible for the conversion of RNA s...
Q: Mutations that affect organisms are those that involve exons. True or False
A: Mutation takes place when section of gene or exons are missing. The most common type of mutation tha...
Q: recessive allele found on the X chromosome.
A: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a disorder that affects the normal function o...
Q: What chemical substances compose the plasma membrane?
A: A cell is the basic structural and function unit of life. It consist of different parts. Cell consi...
Q: If the relative fitness of the A1A1 genotype is 0.6, A1A2 is 1.0 and A2A2 is 0.9, eventually the fre...
A: Introduction :- Fitness is an organism's ability to pass on its genes to the next generation.Relativ...
Q: Recall the five steps of the scientific approach.
A: The scientific method is a collection of procedures for examining phenomena, gaining new knowledge, ...
Q: List three types of alternative splicing patterns and how they leadto the production of different pr...
A: There are a total of five main types of alternative splicing events. These are depicted below: (A) ...
Q: In Figure 5-33, which is the rarest λ genotype producedin the initial lysate?
A: Transduction It is the process with which a virus transmits genetic material from one bacteria to a...
Q: The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC CGTAC...
A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and virtually all other creature...
Q: Make an essay about this. Suppose it is possible to use genetic engineering to make people more inte...
A: Answer :: Genetic Manipulation : Genetic engineering also called genetic modification is the direct ...
Q: How do seven–transmembrane domain G protein–coupled receptors transmit a signal across the plasma me...
A: GPCR, which is expanded as the G protein-coupled receptor is also known by name of the seven-transm...
Q: Question 2 Why do small Arctic mammals enter hibernation whereas larger mammals stay active during t...
A: Hibernation is defined as the process in which the animal decreases it's metabolic rate, energy cons...
Q: Based on the class data from Experiment I, for each of the three populations, describe the effect of...
A: Key points Genetic drift is a mechanism of evolution in which allele frequencies of a population...
Q: Q3M4 DNA AND PROTEIN S X e/1FAIPQLSDP_g5B-629FSHNpGnTMiEppLS4A71zBd4vcUBqNUILubXONw/formRespons 2. W...
A: Introduction:- The leading strand is a strand of nascent DNA that is generated in the same direction...
Q: glutelins molecular weight
A: Glutelins are a class of propain prolamin proteins found in the endosperm of certain seeds of the gr...
Q: What is the greatest cause for threatened species?
A: One of the major cause of the threatened species os the loss of habitat. Destruction of Habitat is ...
Q: Describe the organization of the interphase nucleus. Include inyour presentation a description of ch...
A: DNA is a molecule found in the nucleus by Friedrich Meischer in the late 1860s, but its function was...
Q: As exercise of a set intensity occurs over several hours The ratio of fat to carb calories used stay...
A: * Exercise intensity means the amount of energy required for physical activity per unit of time. *T...
Q: The functional parameters of respiration change with aerobic training O True False
A: Respiration is a metabolic process of taking in oxygen and releasing carbon dioxide. In the process,...
Q: BFR Is an example of "gym science" that has no merit as a training tool was devised at Ball State Ex...
A: BFR stands for blood flow restriction It decreases the blood outflow in veins ( total cut off ) And...
Q: An infertile female cattle with masculinized behavior and non-functioning ovaries, is known as steri...
A: Note: As per Bartleby Guidelines, For Remaining Answers Please Repost The Question. Introduction: Ca...
Q: what is your view on Darwin's theory of evolution? Use the editor to format your answer
A: Darwin was a biologist and naturalist, who gave theory of evolution.
Q: A B Study the diagram then answer the questions that follow. has the thinnest layer, thereby allowin...
A: Introduction: Capillaries are smallest blood vessels.Capillaries bring about the exchange of substan...
Q: How many insect species exist for every mammal species on Earth?
A: Insects are the most abundant species on earth due to their small body size, an abundance of food, h...
Q: When a living cell, which has an outer membrane made of phospholipids, is placed in an aqueous (wate...
A: We know that plasma membrane is a dynamic ,fluid structure and form external boundary of cells. It a...
Q: 1. One type of vertebrate cell that is thought to lack integrins is the erythrocyte (red blood cell)...
A: Integrins are large family of principal transmembrane receptors that facilitates the binding of cell...
Q: What is the body temperature difference of the follicular phase compared to the luteal phase? 2. ...
A: Menstrual cycle consists 3 phases.And they are Follicular phase and Ovulatory phase.And the stage in...
Q: Describe the three basic steps in the formation and fusion of autophagosomes.
A: Autophagosomes are double-membraned vesicles that contain cellular material slated to be degraded by...
I dont't understand my homework. Can you help me with my homework?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?
- The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicases, primase, DNA polymerase III, DNA polymerase I, and ligase. Also, be sure to indicate the 5' and 3' ends of all nucleic acid polymers.Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
- DIRECTION: SEQUENCING: PLACE THE STEPS OF DNA REPLICATION IN THE CORRECT ORDER a. DNA Polymerase adds nucleotides in the 5' to 3' direction.b. Replication fork is formedc. DNA polymerase attaches to the primer.d. Okazaki fragments are bound together by ligase.e. DNA helicase unwinds DNAA student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs, but each DNA duplex consists of a normal DNA strand paired with numerous segments of DNA a few hundred nucleotides long. What has been left out of the mixture? A. NTPs B. DNA polymerase III C. ATP D. DNA polymerase I E. DNA ligaseSelect the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
- Match each protein involved in DNA replication with its correct function in E. coli. An answer can be used more than once. Group of answer choices The major DNA replicating enzyme on both leading and lagging strands Relieves torsional stress upstream of replication forks Unwinds the double helix at replication forks Provides DNA polymerase III with a 3'-OH group paired with a DNA template Extends lagging strands at the ends of linear chromosomes Digests RNA…The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicase, primase, DNA polymerase III, DNA polymerase I and ligase. Also be sure to indicate the 5’ and 3’ ends of all nucleic acid polymers.DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. Youmay use a figure to aid your explanation.
