Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)

Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)

Name: Sketch a LARGE labeled figure showing one replication fork and the syn
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymera

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
For the template DNA below, which includes one labeled end of the template DNA, clearly label the following: The origin of replication The most recently added base on each strand you draw for b & c, marked with an asterisk (star). Where DNA helicase would be & direction it moves. Where DNA ligase will be needed after replication is complete.
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?
You figure out a way to replicate DNA in a test tube by adding double-stranded DNA template, dNTPs, NTPs and all the proteins needed for replication. However, you forget to add DNA ligase. In a well-labelled diagram, fill in the following parts of the growing replication fork shown. 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)
Why does DNA have a leading strand and a lagging strand during replication?Select the correct row below that fills in the following blanks to answer the question above.___1st___ has to attach the new free-floating nucleotides to the ___2nd___ of the newly formed strand. The two strands of a DNA molecule are antiparallel, so in order for the lagging strand to be formed in the same direction, it has to be done in Okazaki fragments going in a ___3rd___ direction. Select one: a. 1st 2nd 3rd DNA polymerase 3' end 5' to 3' b. 1st 2nd 3rd DNA polymerase 5' end 3' to 5' c. 1st 2nd 3rd DNA ligase 3' end 5' to 3' d. 1st 2nd 3rd DNA helicase 5' end 3' to 5'
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? a. Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase. b. Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome. c. DNA replication always occurs in the nucleus. d. Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
A gene encoding one of the proteins involved in dna replication has been inactivated by a mutation in a cell. in the absence of this protein, the cell attempts to replicate its dna. What would happen during the dna replication process if each of the following proteins were missing?a. DNA polymerase B. DNA ligasec. Sliding clamp for DNA polymerased. nuclease that removes RNA primerse. DNA helicase F. primase
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
Place the following steps of DNA replication and repair in the correct order by numbering them from 1 to 5. a. A template strand begins to be replicated. b. If the incorrect base is not identiﬁed and replaced, it remains as a point mutation in the DNA. c. DNA polymerase identiﬁes and replaces most incorrect bases with the correct base, complementary to the base on the template strand. d. An incorrect base is added to the growing strand of DNA. e. Proteins identify and replace any incorrect bases missed by DNA polymerase.
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.