Compare and contrast miRNAs and siRNAs [may have more than one correct answer]. A Both miRNA and siRNA are double stranded RNAs B Both miRNA and siRNA use the RISC machinery C siRNAs use imprecise matching while miRNAs use precise matching D siRNA use slicer proteins while miRNA uses dicer proteins E siRNAs use precise matching while miRNAs use imprecise matching

Compare and contrast miRNAs and siRNAs [may have more than one correct answer]. A Both miRNA and siRNA are double stranded RNAs B Both miRNA and siRNA use the RISC machinery C siRNAs use imprecise matching while miRNAs use precise matching D siRNA use slicer proteins while miRNA uses dicer proteins E siRNAs use precise matching while miRNAs use imprecise matching

Name: Compare and contrast miRNAs and siRNAs[may have more than one correct
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Compare and contrast miRNAs and siRNAs[may have more than one correct answer].ABoth miRNA and siRNA are double strandedRNAsBBoth miRNA and siRNA use the RISCmachineryCsiRNAs use imprecise matching whilemiRNAs use precise matchingDsiRNA use slicer pr

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

miRNA molecules act as specificity factors, which direct effector proteins to target ______ molecules via base-pairing. A. RNA B. Carbohydrate C. Lipid D. DNA E. Protein
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. a. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results? b. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?
If you have an mRNA sequnece below that looks like : 5' cap, Cytidine, CCUCUUUUCC, gene, AAAAA Which parts of the mRNA are included in the 5' UTR?
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?
Compare and contrast the origins and functions of miRNA and siRNA
Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG CAA GTG a.AUG CCG UAG CUU GAG b.AUC GGC UAC GUU CAC c.ATC GGC TAC GTT CAC d.UAG CCG AUG CAA GUG
How many open reading frames are present in the following mRNA sequence? You may find the codon table helpful. 5' AAUGGGAAUUCCCGAUGAAUAUAATCGTCCTGCATUGAUGGUCCAUGCAAGU 3'OH
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak sequence