describe how you would create the program and why referencing which data structure you would use. c++ Write a program that reads a set of floating-point numbers and prints out the ten largest numbers. As you process the inputs, do not store more than eleven numbers. When it holds more than ten values, remove the smallest value, as it cannot be a part of the answer

describe how you would create the program and why referencing which data structure you would use. c++ Write a program that reads a set of floating-point numbers and prints out the ten largest numbers. As you process the inputs, do not store more than eleven numbers. When it holds more than ten values, remove the smallest value, as it cannot be a part of the answer

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter7: Arrays

Section: Chapter Questions

Problem 7PP: (Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point...

See similar textbooks

Similar questions

(Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?
#Basic Python, please help# Roses on a tree can be either red or white, represented with an appropriate data type that you will need to design. In panic mode, you must write a Python program that paints red all the roses on a rose tree. Test your program on 3 trees, each holding at least 7 roses.
Home Work 2: It is required from you to write a code in C language to find the average for any five numbers.
C++ PROGRAM Write a program that accepts an integer and prints the range of numbers starting from 1 to the input (inclusive). Prime numbers will be skipped. Sample Input: Enter a number: 10 Output: 1 4 6 8 9 10
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
C++ A company hired 10 temporary workers who are paid hourly and you are given a data file that contains the last name of the employees, the number of hours each employee worked in a week, and the hourly pay rate of each employee. You are asked to write a program that computes each employee's weekly pay and the average salary of all the workers. The program then outputs the weekly pay of each employee, the average weekly pay, and the names of all the employees whose pay is greater than or equal to the average pay. If the number of hours worked in a week is more than 40 hours, then the pay rate for the hours over 40 is 1.5 times the regular hourly rate. Use two parallel arrays: a one-dimensional array to store the names of all the employees, and a two-dimensional array of 10 rows and 3 columns to store the number of hours an employee worked in a week, the hourly pay rate, and the weekly pay. Your program must contain at least the following functions—a function to read the data from the…
Create a C++ program for the following cases: Required: Program Plan Algorithm Flowchart Pseudocode Iteration Table Sample Run QUESTION: Write a C++ program that will generate and display a magic square. A magic square is a square matrix in which the sum of every row, every column, and both diagonals is the same.
Note:solution using c++ language Pre-Lab 01: Write a program that reads a positive integer x from the user. If x is even, the program prints all the odd numbers between 1 and x – inclusive - each on a separate line. If x is not even, the program prints all the numbers that are multiples of 4 between 1 and x+10 -inclusive -, each on a separate line. Note: As long as the user does not enter a positive number, the program will repeatedly ask the user to enter a positive number. The program must also print an error message "Error- TRY AGAIN – You should enter a positive integer to continue". Úe do.. while to insure the user input.
C++ - When analyzing data sets, such as data for human heights or for human weights, a common step is to adjust the data. This can be done by normalizing to values between 0 and 1, or throwing away outliers. For this program, adjust the values by subtracting the smallest value from all the values. The input begins with an integer indicating the number of integers that follow. Ex: If the input is: 5 30 50 10 70 65 the output is: 20 40 0 60 55 The 5 indicates that there are five values in the list, namely 30, 50, 10, 70, and 65. 10 is the smallest value in the list, so is subtracted from each value in the list. For coding simplicity, follow every output value by a space, including the last one.
C++ A company hired 10 temporary workers who are paid hourly and you are given a data file that contains the last name of the employees, the number of hours each employee worked in a week, and the hourly pay rate of each employee. You are asked to write a program that computes each employee’s weekly pay and the average salary of all employees. The program then outputs the weekly pay of each employee, the average weekly pay, and the names of all the employees whose pay is greater than or equal to the average pay. If the number of hours worked in a week is more than 40, then the pay rate for the hours over 40 is 1.5 times the regular hourly rate. Use two parallel arrays: a one-dimensional array to store the names of all the employees (Name) a two-dimensional array of 10 rows and 3 columns to store the number of hours an employee worked in a week (Hrs Worked), the hourly pay rate (Pay Rate), and the weekly pay (Salary). Your program must contain at least the following functions: a…
C PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: N
C++ c ode. Write a program that prompts the user to input a string and outputs the string in uppercase letters. (Use a character array to store the string.)