Describe the Amplified Fragment Length Polymorphisr (AFLP) method. Give the advantages and disadvantages of this method and give bibliographical references
Q: Compare 2D polyacrylamide gel electrophoresis to LC-MS as a proteomics technique to identify…
A: Polyacrylamide gel is a technique used in organic chemistry, forensic chemistry, genetics, cell…
Q: state why simplicity and speed are top priorities in selecting DNA isolation method
A: DNA isolation is the first basic step that is carried out in biological science to study on that…
Q: Write an accurate and precise differential report on the sanger sequencing technique
A: The sanger sequencing technique is also called chain-termination method which is made to determined…
Q: DNA extraction, PCR, gel electrophoresis, and DNA sequencing of PCR products. Give a description of…
A: DNA extraction is the procedure of isolating the Deoxyribonucleic acid from biological samples. PCR…
Q: Explain why a quantitative PCR analysis cannot determine the size of the initial template sequence…
A: The combination of the probe-based and intercalating dye-based methods brings the potential…
Q: Explain the significance of satellite DNA in DNA profiling technique
A: Deoxyribonucleic acid or DNA is a polymer composed of two polynucleotide chains that coil around…
Q: Explain the reason for the fact that lab should be scrupulously clean when performing the PCR by…
A: Introduction: PCR stands for Polymerase Chain Reaction. It is a technique used in molecular biology…
Q: Write a precise and accurate differential report on Sanger sequencing and next generation sequencing…
A: The process of DNA sequencing is the determination of the order of nucleotides present in the DNA…
Q: Determine the chemical reagents utilized in banana DNA extraction and their roles. What role does…
A: 3. Liquid dishwashing soap This helps split apart the cell membrane made of lipids and the cell…
Q: Describe the components vital for DNA sequencing with the Sanger method
A: DNA sequencing: The process of identifying the correct order of the four nitrogen bases (adenine,…
Q: make a diagram or schematic representation of Restriction fragment length polymorphism or RFLP
A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…
Q: Describe the process of doing a microarray.
A: A laboratory tool is used to measure the expression of thousands of genes at the same time and this…
Q: Describe the composition of a DNA microarray, and explain how it is used.
A: A DNA microarray is a laboratory tool which is used to detect the expression of thousands of genes…
Q: compare and contrast between FASTA and Genbank format
A: In bioinformatics and biochemistry , the FASTA format is a text-based format for representing either…
Q: List all the components and explain their purpose in the reaction mixture used for the dideoxy DNA…
A: The method of evaluating the sequence of nucleotides (As, Ts, Cs, and Gs) in a portion of DNA is DNA…
Q: What are the limitations of BLAST (Basic Local Alignment Search Tool)?
A: Introduction Basic local alignment search tool is an algorithm and programme for comparing primary…
Q: Compare tblastx and tblastn software packages of genome sequence analysis.
A: BLAST stands for Basic Local Alignment Search Tool •What makes BLAST so popular??- Good balance of…
Q: Write precise and accurate differential report on the sequencing techniques
A: Genomics is the study of an organism's entire genome, which contains genetic elements. To sequence,…
Q: Suggest and describe two methods to detect DNA concentration by using in text citation and provide…
A: DNA is genetic material in almost all living organism that transit from one generation to another
Q: What is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis…
A: DNA is a hereditary molecule found in cells that transmits genetic information from one generation…
Q: What do you mean by polyacrylamide gel electrophoresis (PAGE) technique ?
A: To explain: To explain about polyacrylamide gel electrophoresis (PAGE) technique and its uses
Q: What information can be gathered by using DNA gel electrophoresis? Describe the steps in the process…
A: Gel electrophoresis is a molecular biology technique heavily used in laboratories. Electrophoresis…
Q: PCR: The fragment size you see on the gel does not match your predicted length. What do you do
A: PCR (polymerase chain reaction) is a technique used for the selective amplification of the target…
Q: Write an accurate and precise differential report on the next generation sequencing technique
A: The biological sciences have been transformed by next-generation sequencing (NGS). NGS helps…
Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: SANGER SEQUENCING NEXT GENERATION SEQUENCING WRITE A PRECISE AND ACCURATE DIFFERENTIAL REPORT ON…
A: sanger sequencing and next-gen sequencing is that the sanger method only sequences a single DNA…
Q: Describe the purpose and process of DNA finger printing.
A: DNA fingerprinting is the method of recognizing the genetic makeup of individuals through the…
Q: Discuss the principles , uses, advantages and disadvantages of illumina sequencing method
A: DNA copies obtained from PCR is subjected for gene sequencing through different gene sequencing…
Q: Contrast and compare the advantages and disadvantages of the Sanger method with next-generation…
A: Sanger and NGS are two sequencing methods for analyzing the sequences of DNA. The benefits of Sanger…
Q: write a precise and accurate differential report on sanger sequencing and next generation sequencing…
A: The technologies of next-generation sequencing (NGS) are similar to sanger sequencing, but the…
Q: hematic diagram for the procedure in doing DNA extraction, isolation and quantification
A: The deoxyribonucleic acid isolation method frees deoxyribonucleic acid from the cell and {so}…
Q: Compare sequencing method 1 Illumina and sequencing method PacBio for: a. Read length. What are the…
A: Illumina sequencing methods are also called short read methods as they read shorter sequences in a…
Q: Why is gel electrophoresis user in DNA fingerprinting?
A: Introduction: It is a test to identify and evaluate genetic information which is the DNA. It is…
Q: Explain the difference between a DNA profile and a microrarray.
A: Deoxyribonucleic acid (DNA) analysis is an important biotechnological tool that has vast…
Q: Briefly explain the rationales of adding chemicals which can affect DNA stability in polymerase…
A: PCR is widely used to rapidly make millions to billions if copies of a specific DNA sample.
Q: Describe how a DNA sequence can be used as a diagnostic tool.
A: DNA sequencing is a technique for determining the precise sequence of bases (A, C, G, and T) in a…
Q: write the pros and cons of crispr technology in bullet points with explaintion
A: Crispr technology is a technology that edit genes. It is process of finding specific DNA inside the…
Q: In a Sanger sequencing-based PCR reaction, which molecules are more common:
A: The most important techniques available to the molecular biologist is the DNA sequencing by…
Q: Name the scientist who developed a DNA sequencing technique. Understand the sequencing technique
A: The method of determining the order of nucleotides that are adenine, thymine, cytosine, and guanine…
Q: The table shows the presence/absence and size of DNA bands of known samples using gel…
A: Electrophoresis is the separation of molecules in an agarose gel, under the influence of an electric…
Q: DNA bands from each sample lane of the gel electropherogram below.
A: Key points: Gel electrophoresis is a technique used to separate DNA fragments according to their…
Q: Identify three items (aside from water) that must be used in a Polymerase Chain Reaction (PCR) mi
A: Items that must be used in a Polymerase Chain Reaction (PCR) mixture are- MgCl2. dNTPs. Taq…
Q: Construct a calibration curve by plotting the log10 (fragment size) against the distance migrated…
A: The calibration curve for the above technique of DNA fragment separation based on size, will have…
Q: Could actual fi ngerprints taken from human fi ngers be used to perform a DNA fi ngerprint? Explain.
A: DNA is referred to as a genetic material that is present in the living organism from a single…
Q: what are the advantages and disadvantages of Gel electrophoresis in DNA analysis
A: Introduction :- Electrophoresis is a technique used in laboratories to separate DNA, RNA, and…
Q: List down and briefly describe three other sequence alignment tools other than BLAST used in…
A: BLAST can rapidly align and compare a query DNA sequence with a database of sequences, which makes…
Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…
A: The Sanger sequencing method is also called as chain termination method. In this method, dideoxy…
Q: describe next generation sequencing technique
A: The biological sciences have been transformed by next-generation sequencing, a massively parallel…
Step by step
Solved in 2 steps
- Why in the preparation of akaryotype analysis is the useof a substance like colchicineinteresting?What are the approximate sizes of each band and their relative brightness after clean up pcr?Given the following inforation, construuct te restrioction mapof a 2000 bP DNA FRAGment. 1. EcoRi Digestion produces 1100BP & 900 BP 2. PSTI Digestion produces 1500,300, and 200 BP 3. EcoRi+PstI togeter produces 800,700,300,200 BP
- What is mass fragmentography? How is this performed?Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHWhat is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis profile from the Sanger sequencing method?
- Describe FISH analysis and its application in findingspecific DNA sequences in a chromosome.Briefly describe the procedure of AluQuant human DNA quantitation system. Explain why it is important to quantify DNA from the viewpoint of DNA profiling.What are STRs, and why are they useful for DNA profiling?