Q: The structure labelled H is MOST likely (A) a nucleus an acrosome a microtubule a mitochondrion
A: A cell is the fundamental, structural and functional element of the body. The cell contains various…
Q: 1- Label the following diagram, and give a function for each of the structures
A: Tissue is usually defined that they are been made up of a collection of cells. Organs are formed as…
Q: Features of the nuclear envelope includea. ribosomes.b. a double-membrane structure.c. pores that…
A: Introduction Cell is the basic unit of life. All organisms be it single cellular or multicellular,…
Q: Identify the function of the nucleus. O Contains the genetic material (DNA). To photosynthesise to…
A: Nucleus is a membrane bound organelle that contains genetic material of a eukaryotic organism. As…
Q: Identify: 11. Single mitochondrion with large DNA associated with the basal body in the…
A: Trypanosoma belongs to a group of parasitic single-celled flagellated protozoans. It is a member of…
Q: Select the one true statement. Animal cells can have chloroplasts but do not have a nucleus. In an…
A: Cell is the structural and functional unit of life. There are different types of cells. The two most…
Q: Identify the stages in the eukaryotic cell and describe their principal events
A: Eukaryotic cells are cells that are surrounded by a plasma membrane and have a nucleus and…
Q: Describe two type of noncovalent bonds and how these interaction are untilized for molecular…
A: Biomolecules are organic molecules that are comprised of mainly carbon, hydrogen, nitrogen, oxygen,…
Q: The Size, Structure, and Coding Capacity of _________ Vary Considerably Among Organisms.
A: Living organisms are classified into prokaryotes and eukaryotes based on the structure and…
Q: A biological process that occurs in both plants and animals is shown below.
A: Answer:Introduction: Cellular respiration is a mechanism which takes place in the mitochondria of…
Q: Review Concept 8.3. Match the term and its description. Each term can only be used once.
A: Biochemistry is the study of biomolecules and how they interact with each other to bring the…
Q: ranscription takes place in
A:
Q: (1) Use the space provided to plot a suitable graph of these data
A: Disclaimer: - According to Bartleby guidelines, only the 1st question can be answered. Please repost…
Q: Discuss ways that the cryobiology (“freezing biology”) of insects could be manipulated to control…
A: Preservation of the genetic material can be done for various purposes. It is studied under the…
Q: what pairs of models provides the most complete and accurate representation of the cells of grasses…
A: In biology, a cell could be a membrane-bound unit that contains the essential molecules of life and…
Q: Can you explain specifically what's happening in this graph
A: Graph represents a wide data specifically. It is easy way to understand wide data specifically. In…
Q: Answer question 19 showing fully all the steps. Solution should be simplified and easy to understand…
A: The natural resources are divided into two categories- renewable and non-renewable. The renewable…
Q: Provide an example of a molecule that: A. Cannot pass through the cell membrane B. Can pass through…
A: The cell membrane is a biological membrane that separates the interior of all cells from the outside…
Q: escribe four common components that are found in all cells.
A: All Prokaryotes and Eukaryotes have four common components that are found 1. Plasma membrane: The…
Q: The honeycomb made by bees is made up primarily of
A: Ans.The honeycomb made by bees is made up primarily of lipids.
Q: Explain the concept of combinatorial control.
A: Genes are the units of heredity that are transmitted through generations. Genes contain the genetic…
Q: In a eukaryotic cell, where can you observe genes in action? Chloroplasts Nucleus Mitchondria…
A: A cell is the basic unit of life. All living creatures are made up of cells, ranging from…
Q: The fluid mosaic model describes a structure with A. polar layers on the outside and nonpolar layer…
A: Question - The fluid mosaic model describes a structure with A). Polar layer on the outside and…
Q: The information regarding cell functioning is carried out of the nucleus by a. amino acids. b.…
A: DNA is genetic material present inside the nucleus . Nucleus control many activities of the cell .…
Q: which of the following is not a domain in the three domain sysytem
A: Three domain system was given by Carl Woese who suggested that all the organisms of the world can…
Q: Interpreting Graphs Sometimes data is presented in a graphical format instead of in a data table.…
A: Graphs are pictorial representation of numbers and help to extract meaningful information from them.
Q: Draw a schematic to represent the process above. Hint: consider which compartments need to be…
A: Answer to question 6a.
Q: List the correct order for the diagrams in the figure.
A: Events during mitosis is shown. prophase- chromatin condense to form, chromosomes, nuclear envelop…
Q: Compare the way that the image is formed in the TEM and the SEM.
A: TEM is a Transmission Electron microscope. SEM is a scanning electron microscope.
Q: refer to the picture below and select two correct statement.
A: Carbohydrates are the biomolecules that are polyhydroxy aldehydes or ketones. These are classified…
Q: Cells have different types of RNA. Explain the three major types of RNA, where they are located,…
A: There are mainly 3 types of RNA mRNA ( Messenger RNA ) rRNA ( Ribosomal RNA ) tRNA ( Transfer…
Q: Which among the following is the odd one out? Cyclic Pathway Linear Pathway Spiral Pathway Diverging…
A: Metabolic pathways are of two types catabolic and anabolic. In the catabolic pathway, the large…
Q: Cellular inclusions in prokaryotic cells serve to A) store energy rich compounds. B) protect DNA.…
A: Option - D
Q: Prepare a micro-theme comparing and contrasting plant and animal cells. Include the similarities and…
A: Introduction Eukaryotes are organisms having cells that contain a nuclear envelope around their…
Q: Explain the importance of the plans member and describe its 4 main components. Also describe what…
A: The plasma membrane or cell membrane is a protective covering that encloses the contents of the…
Q: 10. Identify the specific structure and predominant protein that comprise this structure. 11.…
A: Cardiac myofibril is composed of muscle cells, which helps in the contraction and relaxation…
Q: explain this figure
A: The structure has one phosphate and 4 oxygen in which 3 oxygen have negative charges.
Q: Report on a development of yeast based platform to boost production natural rare molecules
A: Nowadays, yeast-based platforms are used to boost the production of natural rare molecules. this…
Q: State one way the two molecules could differ that would explain the difference in their ability to…
A: The difference in their ability to pass through a artificial cell membrane are as follows 1)…
Q: DNA and RNA are information-rich molecules. Explain thesignificance and implications of this…
A: Introduction: Nucleic acids are classified into two types: deoxyribonucleic acid and ribonucleic…
Q: Please follow the arrows in order from top to bottom and match with the term that describes the…
A: Anatomy Anatomy is the branch of biology where the study of organisms organs and structure is done.…
Q: Define the term fragmentation.
A: There are several modes of asexual reproduction which occur in plants and microbes based upon…
Q: Illustrate the Yanofsky’s model ?
A: Yanofsky lab research focuses on Arabidopsis thaliana genes involved in fruit development.
Q: features of mitochondria are similar
A: A cell is a small self-contained unit within whole organisms. It is the littlest unit of the body.…
Q: Which of the following is NOT true about mitochondria and chloroplast proteins? A. Proteins of both…
A: The mitochondria are commonly considered as the “powerhouses of the cell”. The energy (ATP)…
Describe the different secondary structures in each model
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- >chromosomal…⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutation
- #3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:A conditional mutation when there is an alteration to the coding region of a gene is caused by a. Base addition. Choose below. X-ray exposure Gene deletion Vaping Tautomeric shiftCorrect answers already provided! Please don't just tell me the answers bc I know them already. Help me with my own question. I get everything else in this problem other than the third option: Introduce the mutant human HD allele as a transgene into the mouse genome with transgene integration anywhere in the mouse genome. Why is the first question (left) okay with introducing mutant human HD allele and the second question (right) is not? I heard that introducing allele without using CRISPR-Cas9 is very rare and difficult. If so, how does it work in the first problem (Hungtinton's chorea)?
- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible（100 words maximum）In cancerous cells, CpG islands are: where intercalating agents are found demethylated methylated
- Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite transposond. retrotransposone. insertional elementSNP variations may be found at every nucleotide in the human genome. True FalseFour cosmid clones, which we will call cosmids A, B, C, and D, werehybridized to each other in pairwise combinations. The insert size ofeach cosmid was also analyzed. The following results were obtained: