Diatoms are protists that have complex glassy structures in their cell walls. These structures form within the Golgi apparatus. How do these structures reach the cell wall without having to pass through the plasma membrane?

Diatoms are protists that have complex glassy structures in their cell walls. These structures form within the Golgi apparatus. How do these structures reach the cell wall without having to pass through the plasma membrane?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter4: Cell Structure

Section: Chapter Questions

Problem 1VCQ: Figure 4.7 Prokaryotic cells are much smaller than eukaryotic cells. What advantages might small...

See similar textbooks

Related questions

Q: In genetic engineering, can we insert the gene from human to E. coli (bacteria)? Explain your…

A: Genetic engineering involves modification of DNA in an organism that alter The characteristics of…

Q: Orte en In How can pressure, size of the molecule, and viscosity affect the rate of diffusion,…

A: Diffusion can be defined as a movement of molecules from the region of their higher concentration to…

Q: Frekles are inherited as an autosomal dominant trait. Red hair is inherited as an autosomal…

A: Autosomal dominant shows inheritance when only one of the two alleles is intact dominant state and…

Q: Using figure (a) above as guide, list the five components in the CRISPR-Cas9 bacterial defense…

A: CRISPR is a acronym for Clustered regularly interspaced short palindromic repeats. It forms a very…

Q: Which of these organelles is directly involved in the synthesis, editing, or modification of cell…

A: The science of cell structure and function is known as cell biology, and it is based on the idea…

Q: Vaccine mandates are often justified as necessary to protect public health (and do the most good for…

A: In order to understand what is ethically wrong or right, ethics explores the intellectual…

Q: Muffy, a color blind female with blood type A (heterozygous to type O) is married to Biff, who is…

A: Given: Muffy, a color-blind female with blood type A (heterozygous to type O), married to Biff, who…

Q: How is biological sex determined?

A: As a result of sex determination, people acquire traits that enable them to be classified as males,…

Q: A) B) O D) 2 Glycolysis is the process where cells split the sugar glucose to make 2 ATP. Both…

A: Introduction :- Prokaryotes are creatures without a nucleus or other organelles in their cells.…

Q: Using an online search, find if ultraviolet light can "kill" SARS-CoV-2. If so, which type(s) of UV…

A: Note:- Sorry, As per the honor code we aren't allowed to cite external references. Thank you!…

Q: Name ten examples of bacteria and give their colony morphology. ( indicate the media used for each)

A: Scientists utilize a technique called colony morphology to define the properties of a specific…

Q: Liver cells are in contact with the blood and exchange a variety of substances with the blood plasma…

A: Plasma membrane is not permeable to all molecules. charge molecules are not permeable to plasma…

Q: Pictured is one of the life stages of an Aurelia sp., or Moon Jellyfish, a Scyphozoan. Which life…

A: Introduction cnidarian, also called coelenterate, is a phylum under the kingdom Animalia containing…

Q: Which of the following enzymes can decatenate replicated bacterial chromosomes? please explain the…

A: Bacterial chromosome is a circular and covalently closed one. Various enzymes are involved in the…

Q: The cell wall is made of cellulose phospholipids proteins starch

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: The contents of a plaque may not always contain a clonal population of phage if: a. Identical…

A: Plaque:- phage infected bacterium usually burst and releases a number of daughter phages which…

Q: You are designing a medical device to collect Carcinoembryonic Antigen (CEA, MW = 180,000 g mol^-1),…

A: Introduction:- The review we get from the reports findings from the experimental models and the…

Q: What enviroment factors would have contributed to there being bacteria on a door handle inside a…

A: Everyday door handles are one of the hotspots for bacteria, especially public handles. Because of…

Q: Below is a table that lists the labeled autosomal genes for this female karyotype. Select the…

A: The question is asking about the genotypes and phenotypes of the MCR-1 gene, LDLR gene, and ABO…

Q: True or false: the antigen binding site of an antibody is found in the variabe region of the…

A: Human body has a ability to fight against the foreign substances that invade our body through the…

Q: The difference between asexual and sexual reproduction is that O A. asexual reproduction occurs only…

A: The generation of descendants can be referred to as reproduction. Asexual reproduction is one of the…

Q: you know that 1.1OU=1um. you have an organism that measures at 12 O.U at 10x. How long is your…

A: The capacity of a microscope to create an image of an object at a scale bigger (or even smaller)…

Q: the bone structure inside the wing of a bird is a clear example of the statement form fix finction.…

A: Density is a one thing that helps with the flying in birds. Hollow bones don't make birds body…

Q: If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have…

A: Introduction The parts of a gene that are translated into proteins are called exons. Introns are…

Q: single-stranded double-stranded thymine cytosine adenine hydrogen negative positive covalent…

A: Complementarity in biological sciences refers to the association of two structures that each operate…

Q: Which organisms in this food web would be strictly classified as primary consumers?

A: Primary consumers make up the second level of the food chain and are herbivores, they feed on…

Q: How will the cell shift its metabolic processes in response to the level of pyruvate and in order to…

A: Cellular respiration is the process by which energy is captured from food in three main stages. They…

Q: Explain the Methods and standards for disposal of biomedical waste

A: Any garbage that contains infectious (or possibly contagious) components is referred to as…

Q: For the below mating, what proportion of offspring will be blood type A? H/h; A/i* H/h; A/i A) 1/4…

A: Introduction The classification of blood based on the presence or absence of antibodies and…

Q: Describe how change, large and small, has an effect on the ecosystem with examples( for large…

A: Ecosystem It is a land where living and non living organisms interact with each others.

Q: Draw the two dipeptides formed from each pair of amino acids. a. tyrosine and lysine b. threonine…

A: Amino acids are the structural unit of proteins. Amino acids (same or different) join with one…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Use the following information collected from a SIZE-EXCLUSION CHROMATOGRAPHY experiment to answer…

A: Smaller molecules enter the beads when the buffer passes through the column, whereas more giant…

Q: Discuss the human life cycle and the purpose of meiosis. (please keep it short) 4 - 5 senttence

A: Life cycle of human: Human beings are made up of a billions of cells. Such large number of cells…

Q: Muscles , joints, lever, plane and connective tissues that involved in lift a heavy box from floor…

A: Introduction To lift a object from the floor various muscle, joints, bone and tissues are involved.…

Q: what kind of chemicals might you add to try to speed up in the action of an enzyme or to inhibit its…

A: Enzymes are very crucial for chemical reactions as they act on the reactants/substrate in such a way…

Q: what rate in drops per minute should the flow rate be adjusted in order to administer the infusion…

A: Given 15 ml of 10% calcium gluconate and 10 ml of a multivitamin infusion are mixed with 500 ml of…

Q: Question:- How can we determine trans-membrane domains of proteins in the absence of crystal…

A: Transmembrane Domain Determination: Transmembrane domain, which are basically alpha helices, can…

Q: neurobiology How does asymmetric cell division and localization of sequential acting transcription…

A: Development biology studies how cells develop into organs and how time and geography impact cell…

Q: Complete Table I to summarize the function of organelles found in eukaryotic cells. Table 1 The…

A: In the question, it is asked to summarize the function of organelles in the eukaryotic cell.…

Q: What effect does time exposure have on the action of a disinfectant?

A: Disinfectant is a chemical compound that either inactivates or destroys microbes on the surfaces…

Q: Cell Structure and Function Match the following organelles to their descriptions 1. 2. 3. 4. 5. cell…

A: A cell is the basic structural and functional unit of living organism. Cell is the basic building…

Q: airways clean. Oribosomes Ocell walls O cilia vacuoles microvilli present on the cells of our…

A: Trachea is a long tube that connects your larynx ( voice box) to your lungs . Trachea is often…

Q: The following image is of a freshwater Hydra sp. (Hydrozoa). Select ALL correct statements below. A…

A: Animal kingdom comprises of all eukaryotic organisms . It is classified into:- (I ) Porifera…

Q: The essay should consider the following: A description of the key features of stem cells when…

A: Tissue engineering It refers to the branch of biomedical engineering that replaces, maintains, or…

Q: What is the Effect of colchicine

Q: An E. coli colony grew on minimal medium supplemented with arginine and leucine. However, bacteria…

A: Introduction :- The coliform bacterium Escherichia coli, usually known as E. coli, belongs to the…

Q: Explain how the process of translation takes place. Use the following terms in your answer:…

A: Introduction: The process of polymerization of amino acids that results in the formation of a…

Q: Question:- 1) Plant cells differs from animal cell because 1) it has chloroplast 2) it had cell…

A: The type of cell which contains typical or true nucleolus, i.e nucleus with nuclear membrane,…

Q: Explain all living cells evolved from a common ancestal cell.

A: About 750 million years after Earth's formation, or approximately 4 billion years ago, it indicates…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Diatoms are protists that have complex glassy structures in their cell walls. These structures form within the Golgi apparatus. How do these structures reach the cell wall without having to pass through the plasma membrane?
What is the evolutionary advantage of bacteria that have flagella vs. bacteria that do not?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Figure 4.7 Prokaryotic cells are much smaller than eukaryotic cells. What advantages might small cell size confer on a cell? What advantages might large cell size have?
Cell walls exist in plant cells for the purpose of rigidity and structure, but how come they are also present in prokaryotes? Which types of cells exactly have cell walls? Is it all cells but animal cells?
You are studying how a newly discovered virus in bats enters their cells. When you examine cells that have taken up the virus, you find virus particles inside clathrin-coated vesicles. What membrane transport mechanismis the virus using to get inside the bat cells? Diatoms are protists that have complex glassy structures in their cell walls. These structures form within the Golgi apparatus. How do these structures reach the cell wall without having to pass through the plasma membrane? What is the evolutionary advantage of bacteria that have flagella vs. bacteria that do not?
Imagine you are looking at a sample of organisms from pond water . You see a single celled organism with flagella . The organism does not have a cell wall and has no chloroplasts ( but does have a nucleus ) . What category from the lab introduction would you classify this organism in ?
Since plants, fungi and prokaryotes have cell walls, why do we classify them in different taxonomic units?
How do the cell walls of fungi and bacteria differ? Only bacteria cell walls contain peptidoglycan. Only bacteria cell walls contain cellulose. Only fungi cell walls contain phospholipids. Fungi don’t have cell walls because they are not cellular.
What differences are there between a free living, single celled organism such as a paramecium and a single human cell such as a ciliated cell of the respiratory tract.
let's say we've just found a single celled organism living in a pond. This organism has a nucleus, a cell wall a plasma, membrane, chloroplast, and flagella. What domain/Keenum is it probably in?
What organelle, not surrounded by a membrane, is found in prokaryotes &eukaryotes?
Many animals and algae have cells with flagella, but do any plants have flagella? For example, do fern cells or moss cells have flagella?
Would you expect a cell of a multicellular organism to be more complex than the cell of a unicellular organism? Less complex? Why?
In observing a cell, you note the presence of flagella. What could you look for to distinguish this specimen between a prokaryotic cell and an animal cell? Group of answer choices Confirm the presence or absence of a plasma membrane. Confirm the presence of a cell wall. Confirm the presence or absence of a nucleus. Confirm the presence or absence of ribosomes.