DNA _____________ glues okazaki fragments together.

Q: Ending ridge, bifurcation, dot, and island are exmaples of some of the characteristics used in…

A: Fingerprints are unique individual characteristics which vary from person to person. No two…

Q: Question: Can two people have the same DNA?

A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of  DNA is unique to all individuals.…

Q: acronym:

A: An acronym is a kind of word that is produced by abbreviating a term by linking specific letters of…

Q: VspI BglI Bath 3나00 12800 12800 2520 1200 1200 720 720 1600

A: Restriction enzymes are defined as DNA-cutting enzymes, and each enzyme will recognize or identify…

Q: (a) State why gamma rays are used instead of alpha or beta particles to kill microorganisms in…

A: Food industry is one of the largest and fastest growing industries. In this type of industry,…

Q: Biological value

A: Protein efficiency ratio: It is defined as a ratio of weight gain of a subject to protein intake.…

Q: Can you help me the name of the labels?

A: The spinal cord is a structure which is continuous structure from the medulla oblongata of the brain…

Q: How radioactivity affects the mankind.

A: Unstable atomic nucleus emits out energy to stabilize it and this phenomenon is called as…

Q: Identify when in a crime scene DNA may become mixed.

A: Blended DNA contains DNA from at least two givers, intensifying DNA investigation by joining DNA…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: Identify the highlighted structure

A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…

Q: Question number 2

A: The kidney is a bean-shaped organ found in all vertebrates; it is present in the left and right…

Q: The process to find limit resolution.

A: Given: The process to find limit resolution.

Q: Match the nuimber in the drawing

A: These are T.S . of Phloem 1. Companion cell 2. Cell wall 3. Sieve bundles 4. Cell membrane 5.…

Q: Choose the option

A: WALKER It is a device which helps to support while walking especially for a person who is physically…

Q: Letter 'B' corresponds to

A: This is the Potential Energy Diagram for a reaction. It is used to predict whether the reaction is…

Q: Griffith and Avery

A: DNA is a genetic material which store all the genetic information of life. DNA encodes the amino…

Q: If a box containing an unknown entity is presented to you for identification whether it is a living…

A: Answer: Introduction: living things means the things or any creature that have ability to grow and…

Q: The Case A murder has occurred right here in our peaceful city of Atlanta. As top-notch biology…

A: Four types of macromolecules are carbohydrates, proteins, lipids, and nucleic acids. They are a…

Q: DNA

A: Answer--

Q: Answer choices are on the second picture

A: Motility is the ability of bacteria to move.

Q: The correct hand washing technique

A: ANSWER;- Five Steps to follow Wash Your Hands the Right Way Cleaning up is simple, and it's perhaps…

Q: phenotypic ratio

A: During reproduction alleles from both the parents are passed on to the gene of offspring. However…

Q: In a crime lab, what precautions should be taken to make sure the DNA wasn't contaminated?

A: Forensic scientists study and inspect evidence from crime scenes and other locations in order to…

Q: Penicillin:

A: The small, unicellular, and mostly prokaryotic organisms are called microorganisms. They are of…

Q: Question 131 All of the following are potentially oncogenic viruses except_ O Hepatitis B & C…

A: Viruses that can cause cancer is termed oncogenic viruses or tumor viruses. They induce cancerous…

Q: Rna to Dna

A: RNA to DNA means Reverse transcription:The initial RNA to DNA conversion that runs in the reverse of…

Q: INTERPRETATION OF RESULTS

A: In the ABO system of classification of blood groups, the antigen present on the red blood cells…

Q: The ___________ method of bloodstain documentationinvolves setting up a border of rulers around the…

A: Blood is known as the vital body fluid of the body in almost all the living organisms that help to…

Q: What is medical coding

A: Nurses are accountable for ensuring that client care documentation is correct, timely, and…

Q: This is a 320

A: The cell is very small in size. It is unable to see by naked eyes. So, scientists used microscopes…

Q: Why CF is the best-researched technique

A: Cystic fibrosis is also known as CF is a common disease that is an inherited disorder that causes…

Q: Can I get an introduction or background information about synthesis and spectrophotometric of…

A: Introduction :-  Aspirin is an drug used to reduce pain means it is an analgesic , reduce…

Q: the main utility and history of nanomedicine

A: Nanomedicine is a branch of medicine that applies the knowledge and tools of nanotechnology to the…

Q: In the subject Forensic Photography, In your own words, define the term Photography, Light,…

A: In the context of forensic photography, the terms are described in step 2.

Q: Am stands for

A: In case of time, navigation, AM: Ante Meridian  In Biology: AM : sometimes referred as  Alveolar…

Q: Write the correct letter in the space provided before each number.

A: Answer Infants and toddlers communication skill development depending on their parental interaction.…

Q: select the following answers

A: Since, individual 1(male a/c to the pedigree diagram) is phenotypically healthy and female 2 is…

Q: Defend the statement "The investigations of Anthony Van Leeuwenhoek changes the world forever"

A: Antonie van Leeuwenhoek was a Dutch microbiologist who was born on October 24, 1632, in Delft,…

Q: detailed working of MRI machine .

A: A magnetic resonance imaging (MRI) is a non-invasive procedure that uses magnetic field and radio…

Q: True or False: Level 2 details cannot individualize afingerprint.

A: A fingerprint is an impression left by a human finger. The friction edges of the fingers often leave…

Q: The individuality of a fingerprint (is, is not) determinedby its pattern.

A: Fingerprints are the old and most correct way for the identification of a person. The fingerprint is…

Q: Identify the picture

A: A red swath of blood flowing from the cut to your heart. On the end, a pimple or a yellowish crust.…

Q: True'and false please with brief explanation.

A: 1.False-A weak acid/base best buffers about 1pH point above and below its pKa. 2.True. If the pH of…

Q: Biology section, biology, please solve question 17

A: According to the question, we have to solve question number 17. So, let us have a look at the…

Q: Modified true or false. Write the correct answer if the underlined word is false.

A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.