DNA polymerase is responsible foreverything listed below excepta. adding nucleotides in the 5' to 3'directionb. removing RNA primersc. reading the template in the 3' to 5'directiond. initiating DNA replicatione. replacing the incorrect nucleotides withthe correct one

DNA polymerase enzymes are enzymes that catalyze the synthesis of DNA molecules from nucleoside…

Answered: DNA polymerase is responsible for…

Science

Biology

DNA polymerase is responsible for everything listed below except

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 8SA: DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required

See similar textbooks

Related questions

Q: Name all the enzymes involved in DNA replication along with their respective function

A: DNA replication is the biological process that results in the production of two identical copies of…

Q: Transformation can be described as Polymerase chain reaction Sanger Sequencing Use of…

A: DNA is one of the genetic material present in the cell. The cell is modified by inserting the…

Q: Which enzymes are involved in protein translation? There are multiple answers. Helicase DNA…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: The enzyme responsible for adding new nucleotides to a growing DNA chain during DNA replication is…

A: DNA is the nucleic acid that stores genetic information.

Q: List the functions of prokaryotic and eukaryotic DNA polymerase enzymes .

A: DNA polymerase is an enzyme that helps in formation of DNA from DNA known as DNA replication. They…

Q: ___________ replication forks are created at the origin of replication.

A: Replication of DNA begins at a single origin of replication, two replication forks are formed which…

Q: Why DNA repair systems is important ?

A: DNA is the genetic material that carries information from parents to offsprings. DNA in a cell can…

Q: Which of the following enzymes do not require a DNA template for nucleotide synthesis? *

A: DNA template is a DNA strand which is copied in to a complementary strand of DNA. According to the…

Q: The palm domain of a DNA polymerase contains the catalytic site of the enzy Ograbs the incoming…

A: Introduction Humans and nearly all other species carry their genetic information in DNA…

Q: Explain DNA polymerase?

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: List the DNA polymerases in prokaryotes and eukaryotes .

A: DNA polymerase is an enzyme that catalyses the synthesis of DNA and replication of DNA .

Q: Multiple sites of replication allow cells to duplicate their DNA ________________.

A: DNA DNA is a long chain of polynucleotides molecules. DNA is either single stranded or double…

Q: Describe the roles of helicase and topoisomerase in DNA replication

A: DNA replication is the process of copying the single DNA strand into two identical copies. It…

Q: The enzyme of E.coli is a nuclease that initiates the repair of double stranded DNA breaks by…

A: unlike the Holliday module of homologous recombination, the double strand break repair [dsb repair]…

Q: List the substances required for replication of DNA catalyzed by DNA polymerase.

A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…

Q: List at least five properties that DNA polymerases and RNA polymerases have in common. List at least…

A: The polymerase is an enzyme that synthesizes the long chains of nucleic acids or polymers. The DNA…

Q: Why does dna polymerase only extend previously existing nucleotides

A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides.

Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…

Q: DNA polymerase replicates DNA producing a _______ strand.

A: Answer: DNA polymerase replicates DNA producing a new complementary strand. Explanation: Duplication…

Q: The following image shows how DNA can be damaged by UV light. In this reaction, UV light promotes…

A: Mutation: It is a heritable change in the genetic material of an organisms that give rise to…

Q: The enzyme ________ separates the TWO DNA strands of the double helix. a. helicase b. ligase…

A: Deoxyribonucleic acid (DNA) is the functional genetic information-carrying molecule present in cells…

Q: The enzyme required to open up the double stranded DNA during replication and form the replication…

A: Replication Replication is a process by which the DNA synthesised exact copies of itself. This is…

Q: DNA replication described as “semiconservative

A: DNA Replication It is the process by which a double stranded DNA can form it's replica or copy.

Q: Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork

A: Deoxyribonucleic acid or DNA is a nucleic acid that composed of two polynucleotide chain that is…

Q: Which enzymes are involved in DNA replications? There are multiple answers. Helicase DNA polymerase…

A: DNA replication is the mechanism by which the eukaryotes and the prokaryotic DNA generates a copy of…

Q: why is only one nucleotide added at the time during DNA replication?

A: DNA is the genetic material of almost all living organisms. It contains genetic information which is…

Q: . Indicate the role of each of the following in DNA replication: (a) topoisomerase, (b) helicase,…

A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…

Q: During DNA replication, topoisomerase breaks (a) peptide bonds (b) disulfide bonds (c)…

A: DNA Replication is a natural process that takes place inside the nucleus of a cell. It is a process…

Q: describe the function of Helicase, and DNA Polymerase in the DNA replication process.

A: DNA helicases are fundamental during DNA replication since they separate double stranded DNA into…

Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer

A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a…

Q: DNA polymerase III adds a nucleotide to the 3' end of the strand. leading strand. All of the answers…

A: Concept used: DNA Replication DNA Replication : The process where the strands of DNA are…

Q: DNA polymerase I adds nucleotides to both ends of the RNA primer to the 3' end of the RNA primer to…

A: In eukaryotes, DNA replication is semi-conservative, semi-discontinous and bidirectional whereas in…

Q: DNA polymerase adds nucleotides to the new strand in the ___________ to _____________ direction.

A: At the time of synthesizing new DNA, free nucleotides can be added by DNA polymerase only to the 3'…

Q: Using the illustration of DNA replication given below label the following:

A: DNA is the hereditary material. At the point when the cell separates, the girl cells get an…

Q: True or False: DNA can be copied outside a living cell. ___________

A: Dna is the genetic material and dna replication is the process where copies of dna are formed and it…

Q: What is the role of TOPOISOMERASES in DNA replication? In simple terms, so that I can understand

A: Topoisomerases (also known as DNA topoisomerases) are enzymes involved in the over- or underwinding…

Q: Using the following DNA sequence what would be the complementary DNA made during replication? TAC…

A: Complementary DNA is synthesized from a mature mRNA strand and it lacks both promoters and introns.…

Q: use the terms RNA primase dna polymerase helicase leading strand and lagging strand to briefly…

A: DNA is the genetic material . It is made of four deoxy nucleotide via phosphodiester bonds .

Q: Describe the functions of the following proteins during DNA replication: (i) Polymerase I (ii) DnaA…

A: DNA replication Replication of the DNA is the process of formation of exact copies of DNA, the…

Q: new DNA molecule is precisely synthesized during the following EXCEPT? A.Trasformation B.…

A: Nucleic acid is a long chainlike molecule composed of nucleotides found in cells of all living…

Q: Differentiate between DNA Polymerase I and DNA Polymerase III

A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides, the building…

Q: DNA replication is called semi-conservative because ___ (all, all or none) of the two new strands of…

A: Replication is the process of formation of identical copies of DNA. It take place in nucleus. It…

Q: DNA topoisomerase makes single or double-stranded cuts in DNA to induce or relax supercoiling or…

A: Different enzymes are involved in the process of DNA replication. Topoisomerases are one such class…

Q: List at least three different types of DNA repair and briefly explain how each is carried out.

A: Deoxyribonucleic acid (DNA) repair is a biological that involves repairing damaged DNA sequence due…

Q: DNA polymerase l moves toward the direction of replication fork creating Okazaki Fragments. * True…

A: Most living organisms that are well defined in terms of that they have DNA as their genetic…

Q: Describe the functions of the following proteins during DNA replication: (i) Polymerase delta (ii)…

A: Introduction DNA replication:- It is the process by which the genome's DNA is copied in cells, It…

Q: Describe the role of DNA ligase in the replication process

A: DNA ligase is an enzyme that joins two segments of DNA. The fragments of DNA are joined together by…

Q: At which point during DNA replication is genetic lost from the telomeres? Enzymatic action of…

A: Replication is the process of making two identical DNA molecules from a double-stranded DNA…

Q: Why is DNA replication is considered a semi-discontinuous process? Explain in detail.

A: Biomolecules are organic molecules present in living organisms. There are mainly four biomolecules.…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

DNA polymerase is responsible for
everything listed below except
a. adding nucleotides in the 5' to 3'
direction
b. removing RNA primers
c. reading the template in the 3' to 5'
direction
d. initiating DNA replication
e. replacing the incorrect nucleotides with
the correct one

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required
The DNA polymerase involved in base excision repair isa) DNA polymerase αb) DNA polymerase βc) DNA polymerase σd) DNA polymerase γ
Which of the following molecules has RNA-dependent DNA polymerase activity? A. DNA polymerase I B. DNApolymeraseIII C. RNApolymeraseD. LigaseE. Telomerase
Which of the following enzymes remove supercoiling in replicating DNA ahead of the replication fork?a) DNA polymerasesb) Helicasesc) Primasesd) Topoisomerases
Which of the following repair pathways produces more mutations during the process of repair? Group of answer choices DNA polymerase IV None of the above All of the above MutSLH DNA polymerase III UvrABC
You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’
Why is an RNA primer necessary for DNA replication a. The RNA primer is necessary for the activity of DNA ligase b. The RNA primer creates the 3’ end for DNA polymerase to add nucleotides c. DNA polymerase can only add nucleotides to RNA d. RNA primer is not necessary for DNA replication
A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs, but each DNA duplex consists of a normal DNA strand paired with numerous segments of DNA a few hundred nucleotides long. What has been left out of the mixture? A. NTPs B. DNA polymerase III C. ATP D. DNA polymerase I E. DNA ligase
During DNA replication, a template strand is used to synthesize a new "daughter" strand of DNA. Below is a sequence of a short segment of DNA. Provide the base sequence in the complementary strand and label all ends. 5’ A A T C G T A A G C T 3’
DNA replication is described as semi-conservative because _____. A. one leading strand and one lagging strand are produced in DNA replication B. all new DNA strands are synthesized continuously C. one new DNA strand is synthesized discontinuously D. DNA replication can never produce DNA molecules which consist of both original DNA stands E. one DNA strand is the template while the complementary strand is not
GIVEN: DNA CODING STRAND: GCG TAC TTT TCA GGT DNA TEMPLATE STRAND ____ ____ ____ ____
An error in copying the DNA nucleotides during synthesis is called a _________________________. Most of these mistakes are found and removed when DNA polymerase _________________________ (does what?) to the newly formed strand. During the process called _________________ _____________, a collection of enzymes remove the error and replace it with the correct nucleotide sequence. This correction process reduces the error rate to only one error for every one billion nucleotides!