Q: The linking of the 5’ end of one Okazaki fragment with the 3’ end of an adjacent Okazaki fragment…
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: Select all of the following that need to be in a polymerase chain reaction that will successfully…
A: Polymerase chain reaction (PCR) is a molecular technique used by scientists to multiply particular…
Q: During DNA replication, as DNA unwinds it can become supercoiled causing twists that stress the…
A: DNA (deoxyribonucleic acid) is a double-stranded molecule in which the two strands wind around each…
Q: 1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction…
A: Given, 1. (a) Restriction sites are usually ______. Recombinant DNA Technology…
Q: purpose(s) of DNA extraction
A: The purpose of DNA extraction are: To study the genetic cause of the disease. For the development…
Q: PCR is used to: Select one: a. Randomly break large pieces of DNA or plasmids into smaller…
A: PCR ( polymerase chain reaction ) is used to amplify a specific segment of DNA . Amplification is…
Q: the RNA primer at the beginning of each Okazaki fragment is removed by : A-DNA polymerase I B-DNA…
A: Replication Replication is defined as the process of synthesis of new DNA from the existing DNA…
Q: Restriction enzymes found in bacterial cells are ordinarily useda. during DNA replication.b. to…
A: Introduction Enzymes plays a vital role in controlling various cellular activities. There are…
Q: ) Base excision repair requires polymerases. B.) In DNA repair by excision, the non-damaged strand…
A: Solution : Correct option is d
Q: 18. An instructor had her students perform this laboratory beginning with setting up their own…
A: Agarose gel electrophoresis is the technique for the separation of DNA fragments on the basis of…
Q: The polymerase chain reaction uses Taq polymerase rather than a DNA polymerase from E. coli, because…
A: Taq polymerase is use to amply the DNA in polymerase chain reaction
Q: Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium…
A: According to the question, Restriction enzymes and DNA ligase play essential roles in DNA cloning.…
Q: DNA polymerase III is a processive enzyme, which means that a. it does not dissociate from the…
A: Ribonudeic acid is produced by an enzyme called RNA polymerase, which is responsible for the…
Q: Match the following polymerases with their function. + DNA Polymerase III DNA polymerase I + RNA…
A: Polymerase : There are a set of enzymes specific for DNA & RNA mainly responsible for…
Q: How is synthesis terminated in DNA Replication? a. DNA Polymerase runs out of template b.…
A: DNA replication is divided into three steps initiation, elongation and termination. In order to…
Q: What is the effect of ionizing radiation on DNA? a. faster replication b. the formation of…
A: The effect of ionizing radiation on DNA is that their is breaks in DNA molecule. Ionizing radiation…
Q: Which technique rapidly replicates specific DNA fragments without cloning in cells? (a) gel…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What was the significance of Meselson and Stahl’s experiments on DNA replication using the heavy…
A: Replication is the preliminary stage of inheritance and the central dogma describes how DNA makes…
Q: Which step follows the assembly of new DNA strands by DNA polymerase? a.DNA ligase seals any gaps…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: The RNA primer at the beginning of each Okazaki fragment is removed by
A: Introduction: The small pieces of the discontinuously synthesized DNA are basically known as Okazaki…
Q: What is a restriction endonuclease? Select one: a. It is an enzyme that cleaves at a specific…
A: Nucleic acids are large molecules that are made up of nucleotides that performs a various function…
Q: f an error is made during replication that is not caught by DNA polymerase, the most likely is that…
A: DNA polymerase is an enzyme which catalyses the synthesis of daughter DNA strand from the parent DNA…
Q: One common feature of all DNA polymerases is that they a. synthesize DNA in the 3′-to-5′…
A: One common feature of all DNA polymerases is that they synthesize DNA in the 5'-3' direction.
Q: The same restriction endonuclease must be used to excise the foreign DNA and bacterial DNA. Select…
A: DNA or deoxyribonucleic acid is a double-stranded molecule, strands of which are coiled around one…
Q: From where do we get primers for sequencing DNA? A) they are synthesized by reverse transcriptase…
A: Primer is a short piece of ribonucleic acid sequence that provides a starting point for DNA…
Q: Spontaneous mutations can arise from a. all answers are correct b. DNA polymerase inserts an…
A: Spontaneous mutation is the mutation which naturally arise and which is not due to exposure to…
Q: E) double stranded DNA separates into single stranded DNA
A: The correct option is E . Double stranded DNA separates into Single stranded DNA .
Q: the most efficient general strategy for whole genome sequencing is ? (a) double the coding sequence…
A: Whole-genome sequencing abbreviated as WGS is a method used to comprehensively analyze the entire…
Q: 1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase…
A: Introduction DNA, or deoxyribonucleic acid, is the carrier of genetic information from generation to…
Q: DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new…
A: DNA replication is heterocatalytic process by which a new DNA strand is synthesized on a old DNA…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…
Q: Considering the Polymerase Chain Reaction (PCR), we can state that: a) It is a technique that…
A: Introduction: Polymerase chain reaction is a method which is used to amplify a small amount of DNA…
Q: Which type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white…
A: 1) Extraction of DNA is a very lengthy process; it can be extracted from any cell, either…
Q: Which of the following Is true of the leading strand? A it is synthesized discontinuously at the…
A: Leading strand is synthesized continuously and lagging strand is synthesized discontinuously. Both…
Q: To produce transgenic bacteria that make insulin, which of the following steps didscientists have to…
A: Insulin is secreted by beta cells of pancreas. It allows glucose to enter the cells to provide…
Q: The elongation of the leading strand during DNA synthesis(A) progresses away from the replication…
A: DNA replication is a biological process in which two identical replicas of DNA are produced from one…
Q: The leading strand in DNA replication requires only one primer for its synthesis. The lagging strand…
A: DNA replication is the semi-conservative process in which each strand of DNA molecule act as a…
Q: The elongation of leading strand during DNA synthesis a. progresses away from the replication fork.…
A: Deoxyribonucleic acid (DNA) is a molecule consist of two polynucleotide chains that coil around each…
Q: Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA…
A: Mutagens are physical, chemical, or biological agent that induces mutation by changing the gene…
Q: In DNA technology, the term vector can refer to(A) the enzyme that cuts DNA into…
A: Plasmids are circular, double stranded unit of DNA, which replicates independently of the…
Q: The DNA polymerase I uses its to remove the RNA primers during DNA replication in E. coli cells.…
A: DNA synthesis is a semiconservative process in both eukaryotes and prokaryotes. This means that each…
Q: The principal DNA polymerase in eukaryotic leading strand DNA replication is: A DNA polymerase B…
A: * DNA polymerase catalyze the synthesis of DNA molecules from precursors of DNA which are essential…
Q: Following a CRISPR mediated DNA double-strand break, how can the DNA be repaired by the cell? Choose…
A: Answer. CRISPR is clustered regularly interspaced short palindromic repeats. These are DNA sequences…
Q: Match each enzyme name in the left column with the correct descriptive phrase in the right column.…
A: The biocatalysts that function to decrease the activation energy and increase the reaction rate are…
Q: When a dideoxyribonucleotide is incorporated into a growingDNA strand,a. the strand elongates…
A: Given: Explain when a dideoxyribonucleotide is incorporated into a growing DNA strand, choose the…
Q: Find out whether the following are true or false. a)Klenow polymerase is E. coli DNA polymerase I…
A: Polymerase chain reaction involes denaturation, annealing and extension steps at varied temperature…
Q: The short Okazaki fragments are Select one: a. spliced together by DNA ligase b. glued together by…
A: Replication is the process of synthesis of daughter stand from the parental strand by the action of…
Q: RNA can be used as a template for the production of DNA through the action of ____. a. ligase…
A: RNA can be used as a template for the production of DNA through the action of ____.reverse…
Q: DNA Repair Systems a. counteract spontaneous and induced mutations b. counteract induced mutations…
A: DNA repair may be classified as a collection of systems that detect and repair damage to DNA…
-
Which of the following molecules has RNA-dependent DNA polymerase activity?
A. DNA polymerase I B. DNApolymeraseIII C. RNApolymerase
D. Ligase
E. Telomerase
Step by step
Solved in 2 steps
- In the dideoxy-sequencing reaction, what terminates DNA synthesis at a particular base? a. The absence of a base on the ddNTP halts the DNA polymerase. b. The ddNTP causes a break in the sugar–phosphate backbone. c. DNA polymerase will not incorporate a ddNTP into the growing DNA strand. d. The absence of a 3′-OH group on the ddNTP prevents the addition of another nucleotide.DNA strands are anti-parallel and DNA polymerase can only synthesize DNA in a 5' to 3' direction. How does the enzyme synthesize both strands at the same time? A. The leading strand is sythesised in Okazaki fragments B. The lagging strand is synthesised in short Okazaki fragments. C. Only one strand is replicated. D. There are more than one DNA polymerase involved.What would be the result if an organism’s telomerase were mutated and nonfunctional? a. No DNA replication would take place. b. The DNA polymerase enzyme would stall at the telomere. c. Chromosomes would shorten with each new generation. d. RNA primers could not be removed.
- Restriction enzymes found in bacterial cells are ordinarily useda. during DNA replication.b. to degrade the bacterial cell’s DNA.c. to degrade viral DNA that enters the cell.d. to attach pieces of DNA together.DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new strands in both direction d. seal gaps in the sugar-phosphate backbone e. catalyze carbon bondingWhy must the lagging strand of DNA be replicated in short pieces a. Because of limited space b. To make proofreading of code easier . C. Otherwise, the helix will become distorted . D. The DNA polymerase can synthesize in only one direction
- Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA polymerase that cause it to malfunction. b. They distort the structure of DNA. c. They are similar in structure to the normal bases. d. They chemically modify the normal bases.Why are mutations more likely to occur in repeated DNA sequences? a. These bases are unstable b. bases in the strand can form base pairs, generating loops that interfere with replication and repair enzymes. c. The repeats hold onto the replication enzymes, causing base mismatches d. the repeats attract and bind to mutagens, increasing the mutation rateOkazaki fragments are ________. A. short RNA primers needed for initiation of polymerization B. fragments of DNA polymerase I that lack 5' → 3' exonuclease activity C. short stretches of DNA formed on the lagging strand D. the smallest subunits of DNA polymerase III
- Topoisomerases are enzymes that can: a. join two DNA fragments to become one. b. catalyze conformational change of a protein. c. cut DNA at specific site. d. catalyze the breaking and rejoining of DNA strands which produces DNA that is either more or less superhelical than the original.DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as starting points B. methylated lipids as start points C. acetylated lipids as start points D. single stranded sequences as starting pointsThe elongation of the leading strand during DNA synthesis(A) progresses away from the replication fork.(B) occurs in the 3′ S 5′ direction.(C) produces Okazaki fragments.(D) depends on the action of DNA polymerase