Answered: DNA primase RNA primer DNA ligase DNA…

Name: The diagram shows a model of DNA replication. The diagram points out a
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The diagram shows a model of DNA replication. The diagram points out a number of enzymes and protein factors involved in the process. If this cell were cancerous, a doctor might be using a chemotherapy drug to prevent the replication process from tak

Science

Biology

DNA primase RNA primer DNA ligase DNA Polymerase (Pola), 3' Lagging strand Okazaki fragment 5' Leading strand Topoisomerase 3' DNA Polymerase (Pol8) Helicase Single strand, Binding proteins

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 19RQ: The initial mechanism for repairing nucleotide errors in DNA is. mismatch repair DNA polymerase...

See similar textbooks

Similar questions

DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
The epsilon subunit of DNA polymerase III is responsible for its _______ activity.A-5'---->3' polymerase B- Sliding clampC-3'----->5' exonuclease activity D-5'------>3' exonuclease activity
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
DNA polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is Select one: a. Telomerase b. DNA Pol-I c. DNA pol-III d. Primase
The exonuclease activity of DNA Pol III increases its: Affinity for hemimethylated DNA Accuracy in replicating DNA Affinity for methylated DNA Processivity
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
The sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA informational strand?