Q: List the derived traits in the angiosperm that make it MOST adapted to life on land, and describe…
A: Angiosperms are also known as “flowering plants”. The majority of plants on Earth are angiosperms,…
Q: Five conditions are required to maintain the Hardy–Weinberg equilibrium in a population. Closed…
A: Introduction: When a population rises Hardy-Weinberg equilibrium for the a gene, evolution ceases…
Q: A B C D1 Forest floor refers to the growth that is found directly on the ground in the forest. This…
A:
Q: The pentose phosphate pathway:
A: The pentose phosphate pathway is help in glucose degradation in most living cell because it is the…
Q: Which of the following populations is most likely in Hardy–Weinberg equilibrium? a. Japanese carp…
A: Introduction :- A crucial foundational idea in population genetics is the Hardy-Weinberg Equilibrium…
Q: In an epic battle, the Green Goblin was able to wound Spider-Man aind collect a samplle of his…
A: Crossing over is a phenomenon that occurs in the linked genes. When the crossing over occurs between…
Q: If the cell whose nuclear material is shown in figure below continues toward completion of mitosis,…
A: This question is based on the mitosis process of the cell cycle.
Q: If you eat salty foods, your ECF becomes concentrated and hypertonic which, technically, could lead…
A: Homeostasis of water and electrolytes are well regulated in our body for normal and healthy…
Q: Which feature is part of a sustainable society?a. recycling and compostingb. use of mass transit in…
A: Humans have exploited the natural resources making some of them scarce and polluted.
Q: Name the respiratory centre found in Pons that is responsible for increasing the breathing rate.
A: Respiratory centre usually present in brain stem especially in the medulla oblongata as well as in…
Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…
A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…
Q: Eagles and bears feed on spawning salmon. If shrimp are introducedthat compete with salmon for…
A: Population interaction can be defines as the interaction between different populations. It refers to…
Q: 2 3 4
A: When when a growth of particular Organism or population is recorded and represented in graphical…
Q: 4. The stage in mitosis in which chromosomes replicate themselves. A. Anaphase B Interphase D.…
A: Cell division is crutial process in all the organism both in unicellular or multicellular organism.…
Q: The ________, found at the tips of roots and shoots, produces new cells which add to the length of…
A: Introduction: Plant tissue with the capacity to actively divide over the course of its life is said…
Q: Draw one red blood cell and at one white blood cell. Label the cell membrane, cytoplasm, chromatin,…
A: Red blood cells are a type of blood cell found in the blood that is produced in the bone marrow. Red…
Q: What is a model organism? A. used by science to be an example for how other organisms would respond…
A: Organism is a living being who is made up of cell or more than one cell. For example: Bacterial…
Q: What is parasitic worms
A: Nutrition is one of the life processes exhibited by living beings.
Q: Based on this information, answer the following questions. a) What is the possible microbial…
A: Inflammation of the cerebrospinal fluid (CSF) and meninges surrounding the brain and spinal cord is…
Q: What immune mechanisms are operative in glomerulonephritis?
A: Glomerulonephritis is minor inflammation in the glomerulus. It may be acute or chronic. It also…
Q: Structure and functions of root hair cells?
A: The root hair cell is an epidermal offshoot that forms hairs of the root of the plant. Essentially,…
Q: 30. Transport media functions to maintain the microorganisms 31. The proper way to store…
A: Introduction A microbiological culture, also known as a microbial culture, is a technique for…
Q: Define the normal age range for the onset of puberty.
A: When a boy or girl reaches puberty, they reach sexual maturity. It results in bodily changes and…
Q: WARM-UP Reviewing Key Terms Identify the terms described by selecting the correct word from the…
A: Q. Identify the terms described by selecting the correct word from the drop down menu…
Q: During which process is ethanol produced? O lactic acid fermentation O alcohol fermentation O citric…
A: Lactic acid fermentation is a kind of anaerobic fermentation used by bacteria, muscle cells etc.…
Q: 1. What WAS the problem with China's population in the past 20 plus years? 2. What did China do to…
A: An area's population growing quickly is referred to as experiencing a population explosion. The…
Q: Which carbohydrate is NOT produced in the pentose phosphate pathway? glyceraldehyde 3-phosphate…
A: Introduction: The pentose phosphate pathway (also known as the phosphoglycerate pathway, pentose…
Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…
A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…
Q: In a randomly mating population of mice, 3 out of 200 mice are anemic. Anemia is a recessive…
A: Introduction The Hardy-Weinberg equilibrium principle states that the allelic frequency in a…
Q: Mortality, natality, immigration, emigration. Per capita growth rate Growth rate Population density…
A: Introduction : A population is any group or species of organisms that may interbreed, exist in a…
Q: Chargaff’s rule states that the amount of _______ in DNA is always roughly equal to the amount of…
A: Introduction :- The Chargaff rule of base pairing and how the two strands of DNA are bound together…
Q: Hobb's method
A:
Q: 15. A student suffered from nausea, diarrhoea and vomitting after he had eaten some undercooked…
A: Nausea feels like the urge to vomit. It is a symptom of food poisoning or infection. Diarrhoea means…
Q: The first animals evolved O 6 thousand years ago 9.900 O 600 million years ago O 600 thousand years…
A: Evolution is the defined as the change in characteristics of organisms or populations over many…
Q: In what part of chloroplasts do the coupled redox reactions occur? stroma membrane thylakoid…
A: Introduction Plants and other living things employ a process called photosynthesis to change light…
Q: Under genetic drift, if an allele’s frequency is 1%, what is the likelihood that it will be lost…
A: Genetic Drift is also called as an allele drift. It is the change in allele frequency by chance.…
Q: 1. What were the clues that led to the identification of the suspect? 2. What do you think the…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Choose the CORRECT sequence of glycine formation. transamination of 3-phosphoglycerate → hydrolysis…
A: Glycine It is an amino acid which is the building block for generating proteins in the body. It has…
Q: Analysis the features of a maize plant and classify it into the appropriate plant group
A: Plants are classified into different groups based on their features. The two main groups of plants…
Q: Why does menstruation occur?
A: Introduction In human females, they have a menstrual cycle which is a cyclical change that occurs…
Q: Give one example of a scientifically testable ecological question at the community level. b. Both…
A: Introduction Ecology deals with the study of the interaction of organisms with their environment and…
Q: What is the difference between resonance energy transfer and photoinduced charge separation?
A: Animal cells produce ATP by cellular respiration, whereas plant cells produce carbohydrates through…
Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…
A:
Q: Your screening facility can process 1,000 people per week. Assume you are attempting the early…
A: Total number of positive: 100(2%) = 20 Total number of negatives: 1000 - 20 = 980 Number of people…
Q: Determine the advantages of phage therapy over antibiotict herapy.
A: The virus known as a bacteriophage assaults bacteria, hence the name. Phage means "to devour," hence…
Q: Flowering rush (Butomus umbellatus) is a pink flowering perennial that has been identified as a…
A: The population growth rate is a number that expresses the amount of population change that has been…
Q: . Critically evaluate the role and reliability of different diagnostic methods in use for difficult…
A: I will be answering the above question by taking Infective endocarditis(IE) as an example:- IE is a…
Q: Why does bladder exstrophy occur?
A: Urinary bladder is a part of excretory system that tends to store urine till it is passed out…
Q: A manager should restrict food handling tasks of an employee who: A. O uses over the counter…
A: To stop the spread of disease through food, the institution has the right to ban or limit a food…
Q: How do the researchers propose to use cancer sniffing worms in real life
A: A disease in which abnormal cells devide uncontrollably and destroy our body tissues is known as…
Do blind people dream in visual images? How can we differentiate so many different foods if we can only taste four flavors on our tongue: sweet, bitter, sour, and salty? Is human blood ever any color other than red? Why do camera flashes make your eyes turn red?
Step by step
Solved in 3 steps with 3 images
- If you can taste only five things (salt, bitter, sweet, sour, umami), why do the many foods you eat all seem so distinct?A patient has had a stroke that damaged the trigeminal nerve but not the facial, glossopharyngeal, or vagus nerve. Would this individual still be able to taste the differenceWould this individual still be able to taste the difference between hot peppers and French fries? Explain your answer.The salivary glands produce saliva. Explain why a tumor in the salivary glands that destroys the saliva-producing cells can interfere with taste sensation.
- What organs gives our body the sense of the touch,protects it, and helps keep it at it keep it at just the right temperature?Your visual field is ______________. a. a specific, small area of the retina b. what you actually see c. the area where color vision occurs d. where the optic nerve startsWhy is your sense of smell and taste diminished when you have a cold?
- When transitioning from a pitch black room, to a sunny room where there is a lot of light, what happens to the cells in the retina? 1. Ganglion cells will release more glutamate 2. Rod cells will release less glutamate 3. Ganglion cells will release less glutamate 4. Rod cells will release more glutamateWhich of the following describes the relationship between taste and eating? a. Taste is sufficient to control eating. b. Taste is necessary for eating. c. Taste is both necessary and sufficient for eating. d. Taste is neither necessary nor sufficient for eating, although it contributes.The taste of food goes to which area of the brain FIRST? a. Hypothalamus b. Medulla c. Parietal lobe of the cortex d. Limbic system
