Q: The capsid of a virus consists of (a) protein subunits (b) nucleic acid (c) helical lipids (d) a…
A: Introduction:- Virus is a small, simple infectious agent that can only multiply in live cells of…
Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…
A: * monozygotic twins even they are genetically identical there will be some variation in them the…
Q: Q4/ What is Osteoporosis disease? Explain the pharmacist role in giving the suitable prescriptions…
A: Across most vertebrate animals, a bone is a hard organ that is part of the skeleton. Bones protect…
Q: From the name "fish tapeworm," one can conclude that the: a) larval stage of the tapeworm occurs in…
A: An intestinal infection caused by a parasite found in fish is known as fish tapeworm disease. The…
Q: 3. What happens when people get vaccinated by the following vaccines? How does a person get…
A: Vaccinations and Immunizations started in the 18th century, with the Smallpox Vaccination, created…
Q: 1. In tomatoes, red fruit (R) is dominant over yellow fruit (r) and tallness (T) is dominant over…
A: Given: In tomatoes, Red fruit (R) is dominant over yellow fruit (r). Tallness (T) is dominant over…
Q: Explain how snakes are related to lizards
A: Snakes and lizards are closely related to each other that belongs tothe order squamata of the…
Q: Two different species of bacteria are growing together in a mixed biofilm in the intestine of a…
A: Autoinducer-2 (AI-2) is a signal molecule produced by LuxS, an enzyme found in many bacterial…
Q: 1. Stress can affect the epigenome of an individual. II. Depending on the affected site, epigenetic…
A: The phrase epigenome comes from the Greek word epi, which means "above" the genome. The epigenome is…
Q: the cytoplasmic membrane is universally similar across the three Domains of life. Discuss this…
A: The cell membrane (also known as the plasma membrane (PM) or cytoplasmic membrane) is a biological…
Q: PROCESS: GASTRULATION
A:
Q: Create a diagram illustrating the level of the organizational structure of the Tilapia fish. To…
A: Tilapia is the broad term for nearly a hundred species of cichlid fish which are are mainly…
Q: Assuming that these are the 12 microplates. What is wrong with the result of the test? What do you…
A: There are few important points : ELISA : Enzyme linked immuno sorbent assay is used in diagnosing…
Q: transalational control is dependent on the stability of mRNA molecules
A: Translational mechanisms can also be used to modulate gene expression. These techniques are…
Q: Allan, a 12th grader, had pancit for lunch. Later on, he observed some itchiness and rashes on his…
A: * Allergies are nothing bur your bodys reaction to harmless substance like pollen grains and molds…
Q: In the very first round of PCR using genomic DNA,the DNA primers prime synthesis that terminates…
A: It is a quick and versatile in vitro molecular biology technique for amplifying the defined target…
Q: Evaluate whether the statements I and II are TRUE or FALSE.
A: Euchromatin is the light staining and less condensed portions of chromatin. This region is…
Q: Cell determination is due to cytoplasmic effectors that cause the cell to irreversibly commit to…
A: Cytoplasmic determinants are special molecules which play a very important role during oocyte…
Q: What does this diagram illustrate? Complete the labels.
A: Bacteriophage is a specific virus that can infect the bacteria. These can cause severe damage to the…
Q: How does gastrointestinal tract evade dehydration? Alternating wave-like contraction and relaxatio…
A: Q) How does gastrointestinal tract evade dehydration? Normal peristalsis movement in the large…
Q: How does KU proteins promote DNA repair during mitosis? Explain.
A: The Ku proteins bind to the linear phage DNA ends and induce LigD to ligate the ends, resulting in a…
Q: In some of the fruits, the floral parts are persistent even up to maturity. Identify these parts.…
A: A fruit is a seed-bearing structure found in flowering plants, often known as angiosperm. Following…
Q: After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…
A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…
Q: how does a light-colored exoskeleton make beetles better adapted to the environment?
A: Introduction Exoskeleton:- It is a rigid or articulated envelope that supports and protects the soft…
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: Review the hereditary structures shown in the diagram. OOO O Structure X Structure Y What are the…
A:
Q: Arrange the statements in their proper order by writing the corresponding letter (e.g. A) for each…
A: * Gene activation and inactivation are the complicated and multistep which are the controlled…
Q: Did the five Big Extinction events in earth's history all occur due to the same environmental cause?
A: There have been five significant mass extinction events in Earth's 4.6 billion-year history, each…
Q: Contrast endotoxins with exotoxins.
A: Introduction :- Endotoxins are lipopolysaccharide-protein complexes that are produced when a cell…
Q: 1) If a human trait is determined by a factor in the cytoplasm, would an offspring more resemble its…
A: If a human trait is determined by a factor in the cytplasm. would an offspring more resemble it's…
Q: 3.Histamine is a signaling molecule that plays a significant role in regulating immune responses…
A: Histamine is a nitrogenous organic molecule that has a role in local immunological responses, as…
Q: 6. Based on your observation of the stigma of th daylily flower in the photo at the right, how man…
A:
Q: You have a mouse model that is a homozygous knockout mutant for the prnp gene (Prnp protein is not…
A: knockout mouse is a genetically engineered laboratory mouse (Mus musculus) in which a specific gene…
Q: The figure above shows succession in an ecosystem. What organisms are found in the climax community…
A: The steady and orderly transformation of an ecosystem caused by the gradual replacement of one…
Q: Given that COVID19 has a single strand RNA for its genome, the number of rounds required to complete…
A: COVID 19 is a SARS virus which causes epidemiological disease called corona virus.
Q: biocatalyst pre-treatment required for biohydrogen production? If yes, then explain any two…
A: Biohydrogen production The biological production of hydrogen is referred to as biohydrogen. Since…
Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…
A: Twins are two offspring produced by same mother in same pregnancy. Twins can be identical and non…
Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…
A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…
Q: What are the different applications of ELISA?
A: ELISA is the basic assay technique, known as enzyme-linked immunosorbent assay (also referred to as…
Q: differential lengths of poly-A tails affect mRNA stability identify which describes the statement…
A: mRNA needs to undergo certain modifications in order for it to be active for translation process.…
Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: functional insulin required the association of two polypeptides known as the A and B chains…
A: Pre transcription control involves in DNA methylation. Transcriptional control involves in…
Q: A massive die-off of lobsters in the Long Island Soundwas blamed on pesticides sprayed to control…
A: Introduction Mosquitoes belong to the Culicidae family, which contains almost 3,600 species of tiny…
Q: Describe the properties of haemoglobin that enable it to carry out its function of oxygen and carbon…
A: Introduction Hemoglobin:- It is a protein inside red blood cells that carries oxygen from the lungs…
Q: 15.Where does the complete digestion of food occur in the gastrointestinal tract? Read and analyze…
A: The digestive system is responsible for the digestion, absorption and assimilation of nutrients that…
Q: Once in human cells, which of the following statements might best describe how COVID19 replicates?…
A: Coronaviruses make full-length copies of their genomic RNA, which are integrated into freshly formed…
Q: Test solution Indicator that can be used Initial colour of the solution Final colour of the solution…
A: Litmus paper is a paper which is prepared with the help of litmus solution. It tells about the…
Q: ASHRAE standard 55, Thermal Environmental Conditions for Human Occupancy, notes that for thermal…
A: A microbe is a living entity that is so tiny that it cannot be seen with the naked eye. Microbiology…
Q: Fill out the blanks of the pedigree (AA, Aa, or aa) How many children did the original couple have?…
A: The pedigree analysis helps us to identifying the mode of inheritance of a particular disease and…
Q: A commercial stage micrometer has a total length of 1000 μm and is divide into 100 equal divisions.…
A: Introduction Meiosis is the cell division process that results in the formation of egg and sperm…
Step by step
Solved in 2 steps
- When a chi square analysis is applied to solve a linkage problem,explain why an independent assortment hypothesis is proposed?In 1-3 sentences each define the follwing terms: complex trait, concordance, environmental variance.Why is the variance larger for a BC1 population compared to an F1 population?
- What is segregation and segregation distortion with major differencesWhat are the two missing genotypes in the Table above ? What is the map distances between the bd and ps loci ? Assuming the map distances are additive, what is the interference ? this is a practice question please helpDoes thephenotype of an organism automatically change when achange in genotype occurs? Why or why not?
