e CRISPR associated protein tinal
Q: The enzyme used to join bits of DNA isa) DNA polymeraseb) DNA ligasec) Endonucleased) Primase
A: The process in which deoxyribonucleic acid (DNA) forms the its copy during cell division is known as…
Q: cleave speciic 4 to d Dase pail sequeices al a. restriction endonucleases b. helicases c. DNA ligase
A: Helicases are enzymes that attach to nucleic acid or nucleic acid associated proteins and might…
Q: Cons of CRISPR
A: The cons or disadvantages of CRISPR are as follows:
Q: O c) Frameshift mutation
A:
Q: Collection of microscopic DNA spots attached to solid surface area) Orthologb) Syntenyc) Paralogd)…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…
A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…
Q: Cxikeria DNA Transcription Translation Location Support Struckures
A: Introduction :- DNA is also known as the Deoxyribonucleic acid. DNA acts the genetic material of a…
Q: ESTION 12 O words or fewer, explain why we think that RNA, and not DNA, was the hereditary material…
A: RNA and DNA are nucleic acids. RNA is a single strand molecule and DNA is a double stranded…
Q: DNA → TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG CTG ATC RNA → rotein → DNA → ACC CGA TAC CTC…
A: The synthesis of m RNA from DNA is called transcription. The synthesis of protein from RNA is called…
Q: DNA Whic corres A. AC B. UG. В. C. UGA D. ACU
A: The process of producing proteins from DNA - deoxyribonucleic acid - sequence involves two major…
Q: Plasmid map of pUCT8/T9 Eco01091 2674 Pfol 46 Aatil 2617 Sspl 2501 Pdml 2294. Bogl 2216 2486 146/
A: Restriction enzymes are the enzymes which cut DNA at a specific location called as restriction site.…
Q: DNA hybridization process using probe
A: DNA Hybridization is the process of combining two complementary DNA single strands allowing them to…
Q: CRISPR in summary
A: CRISPR stands for clustered regularly interspaced short palindromic sequence. It's the gene editing…
Q: Decoding a DNA Message 2. AAT CTC CGA GCT TTG TAG TTA CCC ATT TAG AGT ATC TAG TTG TGT CTC GCT CTC…
A: DNA is a deoxyribose nucleic acid. It is the genetic material of the body and presents mainly inside…
Q: Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG…
A: Original Sequence: GGC TAC ATG GAAMutated Sequence: GGC TAA TGG AA
Q: Cxikeria DNA Transcription Translation Location
A: The central dogma, central to the cellular process functions in transcription by conversion of DNA…
Q: Short DNA sequence having single occurrence in genome isa) Expressed sequence tagb) Sequence tagged…
A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…
Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…
A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…
Q: EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1…
A: Answer :- Option (C) is correct. - 1. :-
Q: O Bacteriophage
A: Virus is there small particles that need the host for its reproduction and prolongation.
Q: DNA coding strand ATG GGA ATT CGC can not get this what the sequence of the complementary template…
A: The DNA strand which functions as template for RNA synthesis is known as template strand, minus…
Q: ATCGTCA AGGCCTA ATCTCAA AGGCCT A Original Strand Mutant Strand Types of Mutation Explain/Why
A: Mutation:- Any alteration in the sequence of DNA that results in altered function or non-functional…
Q: GENE I DNA AGCCTACG C MRNA Amino Acid
A: The correct sequence of mRNA and amino acid name is shown below.
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: d recombinant fraction
A: Genetics can be defined as the branch of biology that is related to the study of genes, genetic…
Q: somatic cells and CRISPR Cas9
A: Cells are the littlest units of life, and subsequently are regularly alluded to as the "building…
Q: Clear frame punos6: Match each vocab word sticky note to the box near the picture that best…
A: Sections of DNA that determine certain traits or characteristics are called genes.Proteins are…
Q: Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)
A: The process of transcription in which RNA is synthesized from the DNA strand is carried out by the…
Q: G-C rich DNA and A-T rich DNA. Which is more prone to errors
A: AT-rich DNA is mostly with condensed chromatin, however GC-rich sequence is located in the dispersed…
Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:
A: According to the central dogma of molecular biology, the information stored in the DNA is first…
Q: Basic pRotein coding gene steucture: TF'S ENA-Pol TSS genomic DNA PROmoteRlexon ATG intreon exon…
A: By the process of transcription mRNA is produced from the DNA. This process occurs within the…
Q: RNA information. below. Parent DNA ATG-AAT-TCG-TAC-AG Replication Transcription Translation
A: The DNA is the genetic material that can inherited from parents to offspring. It contain the genes…
Q: EboV from Guinea pig Reference DNA Sample mRNA Protein
A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…
Q: proteomics translation genetic code antibiotic resistance B-lactam
A: a. Proteomics is the large-scale study of proteins. b. Translation is in this process cell make…
Q: a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5…
A: This is the picture of sanger sequencing gel. The first band is the largest one and subsequent bands…
Q: v constructed gene. What will
A: introduction pGLO is a genetically engineered plasmid which incorporates parts of the arabinose…
Q: Sample D 10 Kb 9 Kb 8 Kb 7 Kb 6 Kb 5 Kb 4 Kb з кь 2 Kb 1 кЬ 0.5 Kb - Marker N No RE w Xho | | udy n…
A: Restriction enzymes are enzymes that cut DNA at specific sites. Each restriction enzyme recognizes…
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: ) whet will be will be the Amout o DNA conteing Product if melogk inG,-Phose ? metonir - 30lg DNA
A: Mitosis - equational division (2n => 2n) Meiosis - reductional division (2n => n)
Q: ent of DNA is usec ranscription. This
A: During DNA transcription DNA strand is transcribed into mRNA with the help of RNA polymerase. DNA…
Q: Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG…
A: A mutation occurs when the sequence of DNA changes. Mutations may occur as a result of DNA copying…
Q: Gly Leu (F) (L) Glu Asp (D) Ser (S) Tyr Ala (A) GUC Cys (C) G U Val (M) U GNP (W). Arg (R) G A C Leu…
A: Any change in the genetic material, which is not caused by recombination, that leads to altered…
Q: What is the DNA complement to this DNA sequence: TGAGCCTTAGGA? O UCTCGGUUTCCT O ACTCGGAATCCT O…
A: The DNA (deoxyribonucleic acid) is genetic material of an organism that it inherits from the parent…
Q: UMM + histidine UMM + tryptophan UMM + lysine
A: They are auxotrophs, they need the appropriate nutrients to grow and then to mate. The cells can't…
Q: GENE B DNA ACCCAACA A MRNA Amino Acid
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.
Q: RNA primer is removed from the Okazaki fragment bya) DNA polymerase Ib) DNA polymerase IIc) DNA…
A: Ans: DNA polymerase I is responsible for the removal of RNA primer from the okazaki fragment.
Q: Index sequences that are small segments of DNA with sequences that are unique and not found anywhere…
A: The DNA is the genetic material in most of the organisms. it is located within the nucleus of the…
Q: b Two short DNA segments are AGCC and CCGA. Are the two segments identical? Yes No Submit
A: DNA ( Deoxyribose nucleic acid ) is ladder like double stranded structure which comprises of two…
Step by step
Solved in 3 steps
- 1. What is the function of the CRISPR/ Cas system 2. Briefly outline the components of the CRISPR/Cas systemIn order to target a specific region of genomic DNA with CRISPR, researchers must include a guide RNA containing a 20-basepair long spacer sequence that matches the DNA sequence at the target site. (i) How many possible guide RNA spacer sequences are there? (ii) One of the possible risks of genetic engineering methods is “off-target” editing, where a modification of the genome occurs in a part of the genome other than the target site. Imagine you design a 20-basepair guide RNA spacer sequence to target a specific portion of the Zebrafish genome, which is 1.7 billion nucleotides long. Assuming all nucleotides are equally common, estimate the probability that your spacer sequence occurs in at least one other position in the Zebrafish genome.Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
- A cDNA and a cloned fragment of genomic DNA share sequences from a mouse gene. What differences do you expect to see between the cDNA and genomic DNA sequences? a. None; they should be identical. b. The genomic DNA might have an intron or introns. c. The genomic DNA might have promoter sequences. d. The genomic DNA might have a poly(A) tail. e. Both b and c are correct.1. Examine the “RNA-Seq Coverage” and the “FlyBase Genes” tracks in the Genome Browser from left to right. At approximately which coordinate (base position) does the RNA-Seq data start? Remember that you can use the navigation controls at the top of the page to zoom in to the region of interest.1. Explain how the SNP changes the recognition sequence for the restriction enzyme and affects its ability to cut the DNA. Indicate which of the 2 alleles (taster or non-taster) is cut by the restriction enzyme. 2. Predict the size of the expected DNA fragments after restriction digest for the two alternative SNP sequences (the taster and the non-taster).i.) Taster allele after being cut ii.) Non-taster allele after being cut
- 1. Why would multi-gene families complicate things in terms of being sure of which member of the family was responsible for a particular phenotype? 2. How could multi-genes families complicate things in terms of using CRISPR to knock out a target gene and achieve a target phenotype?1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII9)A scientist compares the sequence of a disease gene and a healthy gene and finds that these two genes are identical except for one G in place of a T at position 256 in the gene. This type of mutation is a(n): Select one: a. deletion b. insertion c. silent mutation d. frameshift e. substitution mutation
- 1. What makes CRISP particularly useful compared to other genetic engineering techniques? A. CRISPR can add DNA to multiple cells at the same time B. CRISPR works better in bacteria C. CRISPR can target one specific area of DNA to cut D. CRISP is capable of transporting DNA through the cell walls of plants 2. MOST viruses are capable of infecting A. many different species B. many cell types in the same species C. only specific cell types that have a particular receptor1. Which of the following explains why prokaryotes have a bigger gene-to-genome size ratio compared to eukaryotes? A. Prokaryotic genome contains multiple promoters and repressors that control of a single gene.B. Prokaryotic genome is completely devoid of non-coding sequences.C. Prokaryotic genome contains multiple genes that are under the control of a common promoterand repressor.D. Prokaryotic genome contains one promoter region for each gene. 2. Which of the following can explain why eukaryotes have smaller gene-to-genome size ratio compared to prokaryotes?A. Genome size do not correlate with complexity in eukaryotes.B. The percentage of genes is inversely correlated with genome size in eukaryotes.C. Eukaryotic genome contains a lot of coding sequences.D. Eukaryotic genome contains a lot of non-coding sequences.2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.