Q: at Q2. A wine is flash-pasteurized decimal reduction at 60°C of 1.7 min and a z of 7°C. What is the…
A: Given T1 = 600C at 1.7 min T2= 720C at 15 sec z = 70C Formula- = 72-60/7 =…
Q: Which two patterns were observed on Genovesa and Santa Fe in Graph 1? 1. More iguanas of medium…
A: 13 of the Galapagos Island in the Pacific Ocean, is inhabited by marine Iguanas. They are herbivores…
Q: Which crime is mostly associated with stimulants and opioids?
A: Stimulants and opioids Stimulants cover many drugs and speed up the activity of central nervous…
Q: Which of the following does NOT generate a relative measure of population size? Group of answer…
A: Methods of measuring population size : The sampling methods used to determine population size are…
Q: What are the hormone/s that affect the following in the formation of urine (a) Increases surface…
A: Introduction Chemicals known as hormones serve fundamentally as the body's messengers. Specialized…
Q: Mendel's law that showed that the genes inherited for one trait did not affect the genes inherited…
A: Answer. Law of independent assortment
Q: Salicylamides are inhibitors for an enzyme called scytalone dehydratase. SAR shows that there are…
A: Salicylamides are inhibitors for an enzyme called scytalone dehydratase. SAR shows that there are…
Q: diploid individual is heterozygous for a chromosome rearrangement. The original chromosome and its…
A: Meiosis ensures the production of haploid phase in the life cycle of sexually reproducing organisms…
Q: 12) Currently, the only predators of Galápagos marine iguanas are Galápagos hawks. Iguana body size…
A: B- Increase and disruptive. Actually in question its written that the predation have no impact from…
Q: 1. MacConkey agar is selective for what group of bacteria? 2. MacConkey is also a differential…
A: "Media" refers to different types of solid, semi-solid, or liquid formulations that provide similar…
Q: plant cell organelle cooperation. how they all work together
A: Among the three basic components of a cell, there are the membrane, nucleus, and cytoplasm. The…
Q: True or false: A cell's identity is fixed and can not be changed.
A: Our human body consists of trillions of cells each performing its unique function and at the start…
Q: Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a person…
A: Sickle Cell Anemia It is a blood disorder where RBCs take up crescent or sickle shaped. These…
Q: In the autoimmune disease multiple sclerosis, a person's immune system attacks and destroys the…
A: Introduction The nervous system is a major regulatory, regulatory, and communication system in the…
Q: Why is it important to have isolated bacterial colonies for this lab activity (Bacteria of GI…
A: Culture of Bacteria It is also known as microbiological culture. It is a process of multiplying…
Q: Bird Beak Variation Bird beak size is often related to the type of food the bird eats and the size…
A: Answer. 2. Sexual reproduction- sexual reproduction between birds with varying gene Will lead to the…
Q: Draw what galactosemia would look like in your body WITHOUT WORDS and explain it
A: Introduction - • Galactosemia: too much galactose in the blood.- When a person consumes dairy (which…
Q: The primary role of the Calvin cycle in photosynthesis is to: - split H2O and release oxygen -…
A: The primary role of the Calvin cycle in photosynthesis is to: Answer: use the energy in ATP and…
Q: Calculate CO (cardiac output) if given HR and SV.
A: *Cardiac output is a measurement of the amount of blood pumped by each ventricle in 1 min.…
Q: Draw a diagram of galactosemia and explain it
A: Carbohydrates are the biological macromolecules that are composed of oxygen hydrogen and carbon.…
Q: DNA replication involves a series of steps, including initiation, making primers, extension, and…
A: DNA copies itself through a semi-conservative process called replication. When the cell cycle is in…
Q: Question 8 This passage is adapted from Allie Wilkinson, "Panda Guts Not Suited to Digesting…
A: Organisms that derive their food from the surroundings are called heterotrophs. Plants are…
Q: "The cell cycle is the ticking clock that sets the tempo of developmental processes, with…
A: The alternate growth and division phase of cells is known as the cell cycle. The cell cycle is an…
Q: Assuming that pyrazole is not toxic and that it is transported to the liver, evaluate its potential…
A: *alcoholic liver damage which ranges from simple steatosis to cirrhosis and HCC continues to…
Q: In most animal cells, minus end-directed microtubule motors deliver their cargo to the periphery of…
A: Animal cell is a type of eukaryotic cell , multicellular and is without cell wall . It comprises of…
Q: 5. A lichen is a mutualisic relationship between what two organisms? What does each gain in the…
A: The environment has a significant influence on everyone's everyday existence. Ecology helps us to…
Q: Describe the size (in base pairs) of the bands anticipated for Digested TT DNA Digested Tt DNA…
A: Gel electrophoresis is a process of separation of DNA fragments based on their size. Different size…
Q: 32) A) To improve human health with the help of living organisms such as bacteria B) To clean up…
A: Bioremediation is of 3 types Microbial bioremediation ( use of bacteria, algae, fungi etc.)…
Q: identify and label the chromosomes number (1-22). also, identify if it is male or female by labeling…
A: A karyotype is a preparation of the entire complement of metaphase chromosomes found in a species or…
Q: Explain why O- is considered a universal donor and why AB+ is considered a universal recipient.
A: O negative is universal donar as it has no antigen present on its surface therefore it can't elicit…
Q: In what types of markings evidence do striations appear? How are they similar and how are they…
A: Forensic science is concerned with the collecting and examination of physical evidence as well as…
Q: Cystic fibrosis is an inherited disorder that causes affected individuals to excrete greater amounts…
A: Iron levels in adults with cystic fibrosis are frequently low (iron deficiency). This is caused in…
Q: How can the two tight junction strands remain even after the disappearance of claudin-4 caused due…
A: Tight junctions are the structures present between some animal cells to prevent the leakage of…
Q: A fundamental requirement for the functioning of genetic material is that it must be A. replicated…
A: Genetic material is the information present in all organisms that helps their cells to have…
Q: . B. In the rare autoimmune Graves’ disease, antibodies are secreted which over-stimulate thyroid…
A: Grave's disease is an auto-immune disorder and is also known as toxic - diffuse goitre. This disease…
Q: 3. Osmosis Scenario: The video clip mentioned a disaster scenario of a saltwater fish being placed…
A: Introduction :- Osmosis is the naturally occurring net movement or diffusion of solvent molecules…
Q: 4. How important are hydrogen and oxygen in the composition of carbohydrates?
A: Carbohydrates are one of the most important biomolecules that assist in various cellular functions.…
Q: Which of the following is an example of an ecological population? a)All organisms living in a forest…
A: Introduction The individual is the smallest level of ecology. Various individuals combine to form a…
Q: A) Which of the transcription components must be present during the preincubation to keep the…
A: Introduction The term "chromatin" describes the DNA and protein mixture that makes up the…
Q: Muscle cells differ from nerve cells mainly xpress different genes ontain different genes se…
A: The cell:- are the basic building blocks and functional units of all living beings on the earth.…
Q: If red-backed salamanders have a density of 0.15 animals per m2, what is the size of a population…
A: You can estimate how populous a region is by looking at its population density. It can assist you in…
Q: After graduating from UNC Charlotte with the BS in Biology, you are hired as a technician in a U. S.…
A: Cellular response in invertebrates includes nodulation, encapsulation and phagocytosis while the…
Q: PART B-DIAGRAMS & ANSWER QUESTIONS 1. a. Complete the following chart. Labeled Part A J Name of…
A: Introduction There are many different kinds of organelles, each of which is a distinct structure…
Q: What is the mortality (Death rate) and control measures of the following mosquito species: An.…
A: Mortality is the ratio of the number of individuals who died and the total number of individuals of…
Q: basic pH, what does this tell us about the reaction environment? Does this mean higher proton…
A: IAP stands for intraellular acid phosphatase enzyme. In the kinetics assay the progress of reaction…
Q: The hymenopterans have a method of sex determination called ____, which is a type of meiotic…
A: 1 blank- Arrhenotokous parthenogenesis 2 blank-complementary sex determiner (CSD).
Q: The (blank) gene is constitutively active (always making protein).
A: The segment of DNA that can produce a polypeptide is called gene. It is an inherited factor that…
Q: 4. The father has type O blood, the mother has type AB blood. Phenotypic Ratio:
A: Blood group Blood groups are classified based on presence and absence of antigens and…
Step by step
Solved in 2 steps
- 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitutionConvert the following DNA sequences to RNA sequences.Sequence # 1: CCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGGCGACCSequence # 2:CTAAGGTTGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTGSequence # 3:GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTACSequence # 4:CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACGGACATCAGASequence # 5: TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGTTCCGABased on these sequences. Remove codons 24 to 66, inclusive. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
- Place sequences a, b and c into the correct order based on start and stop codons. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGIn the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGIn a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
- What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCABelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?