Eukaryotic MRNAS contain a poly(A) tail at the 3'-end, but the template DNA encoding the mRNA does not have poly(T)s. Identify the statements as true or false. A. The enzyme that makes polyA tail is a template-independent polymerase B. The polyA tail is added at the 3 end of MRNA C. The polyA tail is added at the 5 end of mRNA D. The polyA tail is added by DNA dependent RNA polymerase E. PolyA tail plays an essential role in transcription

Eukaryotic MRNAS contain a poly(A) tail at the 3'-end, but the template DNA encoding the mRNA does not have poly(T)s. Identify the statements as true or false. A. The enzyme that makes polyA tail is a template-independent polymerase B. The polyA tail is added at the 3 end of MRNA C. The polyA tail is added at the 5 end of mRNA D. The polyA tail is added by DNA dependent RNA polymerase E. PolyA tail plays an essential role in transcription

Name: Eukaryotic MRNAS contain a poly(A) tail at the 3'-end, but the templa
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Eukaryotic MRNAS contain a poly(A) tail at the 3'-end, but the template DNAencoding the mRNA does not have poly(T)s. Identify the statements as true orfalse.A. The enzyme that makes polyA tail is a template-independent polymeraseB. The polyA tail is

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGA
Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?
Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
You are given the following mRNA sequence. You know that it contains some UTR sequence and the beginning of the coding sequence of a gene. 5’ ACGGUAUCUAUGGAUUCUGAGGUUGCUGCUUUGGUUAUU 3’ Part A: Write the amino acid sequence for this portion of the coding sequence. Part B: Write the double-stranded DNA sequence that corresponds to the mRNA above. Label 5’ and 3’ ends. Would transcription have occurred using the top or bottom strand as the template?
Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequence
We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?