And where does this goes too this type is believed to be caused by viral destruction islets VE V=Diabetes results from the body's inability to properly handle glucose. Two forms of this disease exist, termed type 1 and type 2diabetes. Categorize the following choices, which include descriptions and symptoms, to distinguish between type 1 and type 2diabetes.aw11LabelsThis type oftenoccurs in peoplewho areoverweight.The causes for thistype can involvegenetic factors.The pancreas doesnot produceenough insulin inthis type.Reset AllType 1 Diabetes (1/2)< PrevType 2 Diabetes (2/2)19 of 46www.wwwNext > 0This type can beprevented ormanaged with dietand exercise.This type is theresult of impairedinsulin receptors.This type requiresdaily insulininjection.This type leads to abuildup of ketonesin the blood; thiscan lead to comaand death.

Let us first briefly explain type 1 and type 2 diabetes milletus. Type 1 diabetes milletus: Type 1…

EV Diabetes results from the body's inability to properly handle glucose. Two forms of this disease exist, termed type 1 and type 2 diabetes. Categorize the following choices, which include descriptions and symptoms, to distinguish between type 1 and type 2 diabetes.

EV Diabetes results from the body's inability to properly handle glucose. Two forms of this disease exist, termed type 1 and type 2 diabetes. Categorize the following choices, which include descriptions and symptoms, to distinguish between type 1 and type 2 diabetes.

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter19: The Peripheral Endocrine Glands

Section: Chapter Questions

Problem 5TAHL

See similar textbooks

Related questions

Q: What are the symptoms of myxedema? Multiple Choice O tremors in the hands, shaking, balance…

A: Introduction Thyrodisim is of two types hyperthyroidism and hypothyroidism. myxedema is…

Q: What type of cell can launch their receptors as antibodies? O Helper T cells O Macrophages Killer T…

A: An antigen can be referred to as a substance that prompts the body to produce a particular immune…

Q: The difference between PCR and real-time PCR is that real-time PCR: can determine the DNA sequence,…

A: The correct answer is option C. can measure the amount of DNA amplified as the reaction proceeds,…

Q: Which of the following describes the most likely mechanism of membrane transport used by seawater…

A: C. Active Transport Marine fish means the fishes living in saltwater remove the salt through their…

Q: peptide hormones and growth factors act on target cells by binding to receptors located at the:…

A: Introduction Just like different cellular peptides, peptide hormones are encoded in genes, that is…

Q: Discuss which attributes you feel are necessary for a successful career in the lab field and why.

A: Attributes are the traits that make us successful. Lab is a place where we do experiments.

Q: Do mRNA levels increase or decrease as DNA methylation increases?

A: DNA is a molecule that is composed of two strands of polynucleotides. It stores genetic information…

Q: Occlusion of which of the following arteries is most likely to produce loss of tactile sensation in…

A: The brain regulates all bodily processes, processes information from the environment, and embodies…

Q: will it affect much or less?

A: The Bradford assay is measured at 595nm in spectrophotometer.

Q: Cells that are undergoing the process of mitosis contain condensed chromosomes that are attached to…

A: The question is related to the cell division , in the cell division there are several steps where…

Q: Skeletal productivity can be quantified by dividing the maximum diameter of the ____ by the diameter…

A: Skeletal robusticity indicates the strength of a skeletal section in relation to some mechanically…

Q: Use your knowledge of climate patterns and characteristics of each biome to explain the worldwide…

A: A biome is a biogeographical unit made up of a biological community that has developed as a result…

Q: Elobrate the research methodology of sampling design for andragogy

A: Andragogy is an approach to adult learning that is based on the understanding that adults have…

Q: Choose the answer that correctly fills in the blanks. As carbon dioxide accumulates in the…

A: More carbon dioxide is evaporating into the ocean as a result of human-driven increases in…

Q: a- Species who are in the same clade are considered to have divergent evolution. b-An example of…

A: The term "theory of evolution by natural selection" was first coined by Charles Darwin and Alfred…

Q: Draw and label the parts of the growth curve

A: Bacteria are prokaryotic, unicellular organisms and they reproduce by binary fission. During binary…

Q: A double-stranded DNA molecule with the sequence shown below produced a peptide. a) Label the start…

A: Transcription generates several kinds of RNA from DNA. Transcription would be similar to making…

Q: What is Scientific revolution? Why do we students have to learn about this?

A: Answer : Early modern science was reproduced during the scientific revolution, when discoveries in…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…

Q: What different purposes are bean beetles used for?

A: Bean beetles are agricultural pest insects from the tropics and subtropics. Bean beetles are a…

Q: respiration and fermentation occurring in yeast cells; what are these metabolic activities and how…

A: *Respiration is a metabolic process in which living cells obtains energy in the form of ATP by…

Q: Consider the scenario where a mouse was bitten by a snake that injected venom into their circulatory…

A: Introduction : Acetyl choline is a neurotransmitter. It is released when an impulse reaches the…

Q: Despite a low net primary productivity (NPP), which ecosystem or life zone produces the most biomass…

A: SOLUTION:- Net Primary Productivity OR NPP:- Net Productivity or NPP is a gross productivity…

Q: What is the benefit of using Next-Gen sequencing instead of Sanger sequencing? You can use…

A: The correct answer can be identified as follows- C. Faster and more copies can be sequenced at a…

Q: For this plant with binomial name Ixora coccinea L., What is the reference to the publication of…

A: Linnaeus named the genus Ixora in 1753; but, historically, it has frequently been merged with the…

Q: Female Reproductive System Assignment 1. Describe the structure and function(s) of each part of…

A: Dear student, As per the guidelines, I will answer the first 3 questions for you. Please repost the…

Q: Which of the following IS NOT a form of cell-to-cell communication? Release of a steroid hormone by…

A: A step-by-step process, cellular communication involves the production of an extrinsic signal,…

Q: Squirrel’s probable causes for the endangerment, extirpation, etc Please include references you use…

A: Due to some human activity, species can enter into a new geographical area which is different form…

Q: In a certain population of frogs, 120 are green, 60 are brownish green, and 20 are brown. The allele…

Q: you did not provided the whole worksheet

A: Asexual reproduction involves only a single parent while sexual reproduction involves two parents as…

Q: An evolutionarily stable strategy (ESS) is a Group of answer choices strategy that, if adopted by…

A: Introduction Evolutionarily stable strategy (ESS):- A behavior that all animals within the…

Q: bottlenecks. What are the typical growth rates and what are the requirements for microalgal growth…

A: Algae can be grown into photobioreactors, open ponds, raceways or closed systems.

Q: Why should bacterial culture plates be incubated inverted (bottom up)?

A: Microbial isolation is a process done in microbiology lab in order to obtained microbe of interest…

Q: 12. Ashley DONLO Can you curl your tongue? Tongue-curling in humans (T) is a dominant genetic trait.…

A: Genetics is the study of gemes and heredity of how certain characteristics or qualities are passed…

Q: Cite instances in the natural setting where the phenomenon of genetic drift

A: Genetic drift is an accidental evolutionary shift in the allelic frequencies of a population.…

Q: Z-scale descriptors are also calculated for artificial (synthetic) amino acids. Which of the…

A: Three descriptive scales—z1, z2, and z3—are employed for peptide QSAR. In this case, z1 refers to…

Q: Which may pose more of a challenge in data collection: naturalistic observation or participant…

A: Naturalistic observation involves observing participants' spontaneous behaviour while they are in…

Q: which of the following correctly describes how protein kinase A can activate genes? A: nuclear…

A: By activating cAMP-dependent protein kinase-A (PK-A), which is activated when cAMP binds to the…

Q: Using pencil, you will draw a representation of DNA replication along the leading and lagging…

A: DNA replication is the process that occurs in all living organisms replicate their DNA during…

Q: Which policy simplified and streamlined the process for FDA approval of generic drugs in exchange…

A: In accordance with the "Drug Price Competition and Patent Term Restoration Act of 1984," also…

Q: What are the 3 types of post-transcriptional modifications and what are they for?

A: Transcriptional modification is a set of biological processes in which an RNA transcript is…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do…

A: DNA replication is a process in which a double stranded DNA will be copied to produce two identical…

Q: What environmental factors affect the affinity of Hb for oxygen? Which way do they shift the…

A: The red blood cells are specialized to carry oxygen . So they contain lots of molecules called the…

Q: Please consider Figures, 10.28, and Table 10.2 (attached), which contain data that were collected by…

A: Field tests revealed that age, rather than pollination, is what causes the green-to-red colour…

Q: Carbohydrates Proteins Triglycerides Acids Where Digestion Begins Where Digestion Ends How Subunit/…

A: Digestion is critical because your body requires nutrients from food and drink in order to function…

Q: All of the following are required to create a cDNA library EXCEPT: Group of answer choices DNA…

A: ddNTPs since A cDNA library is a collection of cloned complementary DNA (cDNA) fragments that have…

Question

And where does this goes too

this type is believed to be caused by viral destruction islets

VE V
=
Diabetes results from the body's inability to properly handle glucose. Two forms of this disease exist, termed type 1 and type 2
diabetes. Categorize the following choices, which include descriptions and symptoms, to distinguish between type 1 and type 2
diabetes.
aw
11
Labels
This type often
occurs in people
who are
overweight.
The causes for this
type can involve
genetic factors.
The pancreas does
not produce
enough insulin in
this type.
Reset All
Type 1 Diabetes (1/2)
< Prev
Type 2 Diabetes (2/2)
19 of 46
www.
www
Next >

0
This type can be
prevented or
managed with diet
and exercise.
This type is the
result of impaired
insulin receptors.
This type requires
daily insulin
injection.
This type leads to a
buildup of ketones
in the blood; this
can lead to coma
and death.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Diabetes type .....is characterized by.....effectively be managed by diet and exercise. 1 (one); an inability of the pancreas to produce sufficient levels of insulin O Il (two); an inability of the body to respond to insulin produced by the pancreas O Ill (three); the inability of the body to release glucose into the blood stream an emergency in response to adrenaline. O I (two);an inability of the pancreas to produce sufficient levels of insulin O 1 (one);an inability of the body to respond to insulin produced by the pancreas
Which of the statement given below is correct relatively to GTT?A. Correlates with determination of potential abnormalities of glucose toleranceB. Helpful to choose the most appropriate treatmentC. Used to differentiate type of diabetesD. Indicate stage of diabetesE. Useful in the seeking of early diabetic complications
Becky has lost 30 pounds over the past several months, even though herappetite has been good and she has been eating more than usual. Shecomplains to her physician that she is nervous and restless, has a shortattention span, becomes fatigued easily but cannot sleep well, movescompulsively, and sweats excessively. Her physician notes that she alsoexhibits tachycardia. Suspecting hyperthyroidism, he orders a blood test,which indicates elevated levels of T3 and T4 and low levels of TSH. Beckyalso has a TSH-like immunoglobulin in her plasma. Explain these results.
Diabetes mellitus is characterized by insufficiency of thepancreas to produce enough insulin to regulate the blood sugarlevel. In type I diabetes, the pancreas produces no insulin, andthe patient is totally dependent on insulin from an externalsource to be infused at a rate to maintain blood sugar levelsat normal levels. Hyperglycemia occurs when blood glucoselevel rises much higher than the norm (>8 mmol/L) for pro-longed periods of time; hypoglycemia occurs when the blood sugar level falls below values of 3 mmol/L. Both situations canbe deleterious to the individual’s health. The normal range ofblood sugar is between 3.8 and 5.6 mmol/L, the target rangefor a controller regulating blood sugar.A patient with type I diabetes needs your help to maintainher blood sugar within an acceptable range (3 mmol/L<glucose<8 mmol/L). She has just eaten a large meal (a disturbance) that you estimate will release glucose accord-ing toD(t)=0.5e−0.05t,wheretis in minutes andD(t)is inmmol/L –…
Development of type 2 DM is characterised by:A. Overwhelming secretion of β-cells in Langerhans isletsB. Overwhelming secretion of α-cells in Langerhans isletsC. Increased insulin sensitivityD. Decreased glucose level in plasmaE. Hypercortisolism
Insulin should be prescribed under all of the following circumstances, except:A. Status post pancreatectomyB. Type 2 diabetes with diabetic foot syndrome C. Type 1 diabetesD. Gestational diabetesE. Type 2 diabetes
Injection therapy uses intermediate or long-acting insulin to cover the body’s:a) Basal insulin needsb) Bolus insulin needs
ndicate whether each of the following statements is true or false. If false, correct the statement or provide a briefexplanation for why it is false.a. Insulin increases the rate of glucose uptake by the tissues.b. Glucagon is the hormone that signals low blood glucose levels.c. The muscles can use glucose, fatty acids and ketone bodies for fuel.d. Epinephrine stimulates breakdown of glycogen in muscles when there is an immediate needfor energy by muscle cells.e. Glucagon stimulates glycogenolysis to maintain the blood glucose concentration.f. With high [carbohydrate] levels, excess glucose (after glycogen storage has reached amaximum) is converted to fat.g. The high potential electrons of NADH enter the respiratory chain at NADH-Q reductase.h. Ubiquinol (QH2) is also the entry point for electrons from NADH of flavoproteins.i. Cytochrome reductase catalyzes the transfer of electrons from cytochrome c to O2.
The following clinical features of Addison’s disease are all correct, except:A. Diffuse lipomatosisB. Weight lossC. HyperpigmentationD. HypotensionE. Dyspepsia
ndicate whether each of the following statements is true or false. If false, correct the statement or provide a briefexplanation for why it is false.d. Epinephrine stimulates breakdown of glycogen in muscles when there is an immediate needfor energy by muscle cells.e. Glucagon stimulates glycogenolysis to maintain the blood glucose concentration.f. With high [carbohydrate] levels, excess glucose (after glycogen storage has reached amaximum) is converted to fat.g. The high potential electrons of NADH enter the respiratory chain at NADH-Q reductase.h. Ubiquinol (QH2) is also the entry point for electrons from NADH of flavoproteins.i. Cytochrome reductase catalyzes the transfer of electrons from cytochrome c to O2.