DNA replication drawing DNA Replication DrawingUsing pencil, you will draw a representation of DNA replication along the leading and lagging strands.Follow the directions below, drawing each element in its proper location along the replicating DNAstrand. Once you are sure everything is in the correct place, complete your drawing by adding color todistinguish objects as separate.Name:1. On the diagram below, label the 5' and 3' ends of both parental DNA strands (you can make upwhich is which)2. Label the replication fork3.Draw and label helicase4. Label the overall direction of DNA replication5.Draw and label single stranded binding proteins6.Draw and label the leading strand7. Draw and label a single DNA polymerase III on the leading strand8. Draw and label an RNA primer on the leading strand9. Draw and label a DNA polymerase I on the leading strand10. On the lagging strand, draw and label at least three Okazaki fragments11. On the lagging strand, draw and label at least two DNA polymerase III enzymes12. On the lagging strand, draw and label at least two RNA primers13. On the lagging strand, draw and label at least one primase enzyme14. On the lagging strand, draw and label at least one DNA polymerase I enzyme15. On the lagging strand, draw and label at least one DNA ligase enzymeHHUTTTTT

DNA replication is the process that occurs in all living organisms replicate their DNA during…

Using pencil, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate.

Using pencil, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 8P: Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second...

See similar textbooks

Similar questions

Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a) origin of replication, (b) polarity (5′ and 3′ ends) of all template and newly synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) locations of primers.
Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)
Which statements are true? Explain why or why not.1 The different cells in your body rarely havegenomes with the identical nucleotide sequence.2 In E. coli, where the replication fork travels at 500nucleotide pairs per second, the DNA ahead of the fork—in the absence of topoisomerase—would have to rotate atnearly 3000 revolutions per minute.3 In a replication bubble, the same parental DNAstrand serves as the template strand for leading-strandsynthesis in one replication fork and as the template forlagging-strand synthesis in the other fork.4 When bidirectional replication forks from adja-cent origins meet, a leading strand always runs into a lag-ging strand.5 DNA repair mechanisms all depend on the exis-tence of two copies of the genetic information, one in eachof the two homologous chromosomes
A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Draw the structure of the double Holliday junctionthat would result from strand invasion by both ends of thebroken duplex into the intact homologous duplex shownin Figure Q5–3. Label the left end of each strand in the Hol-liday junction 5ʹ or 3ʹ so that the relationship to the paren-tal and recombinant duplexes is clear. Indicate how DNAsynthesis would be used to fill in any single-strand gaps inyour double Holliday junction.
If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity