Example 12.7 Write a program that will receive a filename and a line of text as command line arguments and write the text to the file. Figure 12.7 shows the use of command line arguments. The command line is F12 7 TEXT AAAAAA BBBBBB CCCCCC DDDDDD EEEEEE FFFFFF GGGGGG Each word in the command line is an argument to the main and therefore the total number of arguments is 9. The argument vector argv[1] points to the string TEXT and therefore the statement fp = fopen(argv[1], "w"); %3D opens a file with the name TEXT. The for loop that follows immediately writes the remaining 7 arguments to the file TEXT.

Example 12.7 Write a program that will receive a filename and a line of text as command line arguments and write the text to the file. Figure 12.7 shows the use of command line arguments. The command line is F12 7 TEXT AAAAAA BBBBBB CCCCCC DDDDDD EEEEEE FFFFFF GGGGGG Each word in the command line is an argument to the main and therefore the total number of arguments is 9. The argument vector argv[1] points to the string TEXT and therefore the statement fp = fopen(argv[1], "w"); %3D opens a file with the name TEXT. The for loop that follows immediately writes the remaining 7 arguments to the file TEXT.

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter8: I/o Streams And Data Files

Section8.1: I/o File Stream Objects And Functions

Problem 3E

See similar textbooks

Similar questions

Python 3.7.4 Store four file objects corresponding to the files winter2003.txt , spring2003.txt, summer2003.txt, and fall2003.txt in the variables winter, spring, summer, and fall (respectively), and open them all for reading.
Compulsory Task 1 Follow these steps: ● Create a new java file called MyFile.java ● Write code to read the content of the text file input.txt. For each line in input.txt, write a new line in the new text file output.txt that computes the answer to some operation on a list of numbers. ● If the input.txt has the following: Min: 1,2,3,5,6 Max: 1,2,3,5,6 Avg: 1,2,3,5,6 Your program should generate output.txt as follows: The min [1, 2, 3, 5, 6] is 1. The max of [1, 2, 3, 5, 6] is 6. The avg of [1, 2, 3, 5, 6] is 3.4. ● Assume that the only operations given in the input file are min, max and avg and that a list of comma-separated integers always follows the operation. You should define the functions min, max and avg that take in a list of integers and return the min, max or avg of the list. ● Your program should handle any combination of operations and any length of input numbers. You can assume that the list of input numbers are always valid integers and that the list is never empty. ●…
C Programming Task Write a programme called pgmReduce which takes 3 arguments:1. an input file (either ASCII or binary)2. an integer factor n, and3. an output fileand reduces the input file by that factor in each dimension. For example, if the invocation is:pgmReduce inputFile 5 outputFileand inputFile is a 13x17 image, then outputFile should be a 2x3 image in which only thepixels with row and column of 0 modulo 5 in the inputFile exist
Write a program countfile.c that calculates and prints on screen the number of bytes or number of lines in a file. To print the number of lines in the file myfile.txt, the program is run from the command line with two arguments as follows countfile.exe -l myfile.txt or, to print the number of bytes in the file myfile.txt, it would be run as countfile.exe -b myfile.txt EXAMPLE: Suppose the file myfile.txt contains the following samantha jacob 58 91 Then running countfile.exe -l myfile.txt would print 4 on the screen. And running countfile.exe -b myfile.txt would print 15 on the screen. If as a switch anything other than -l or -b is used, the program should give an error message and exit with code 1. If the file is not found, then it should give a message saying no such file exists, and exit with code 2. If everything runs correctly the program should return 0.
C Program Task Write a programme called pgmReduce which takes 3 arguments:1. an input file (either ASCII or binary)2. an integer factor n, and3. an output fileand reduces the input file by that factor in each dimension. For example, if the invocation is:pgmReduce inputFile 5 outputFileand inputFile is a 13x17 image, then outputFile should be a 2x3 image in which only thepixels with row and column of 0 modulo 5 in the inputFile exist.
from Big Java 6th. Edition. Ch.11 P11.12: the capacitor is represented by the equation v(t) = B(1 - e-t/(RC)) Suppose the parameters of the electric circuit are B = 12 volts, R = 500 Ω, and C = 0.25 μF. Consequently v(t) = 12(1 – e-0.008t) where t has units of μs. Read a file params.txt containing the values for B, R, C, and the starting and ending values for t. Write a file rc.txt of values for the time t and the corresponding capacitor voltage v(t), where t goes from the given starting value to the given ending value in 100 steps. In our example, if t goes from 0 to 1000 μs, the twelfth entry in the output file would be: 110.00 7.02261 Make sure that your program catches the FileNotFoundException that can occur if your input file params.txt cannot be found. Your program should catch this exception, and then prompt the user for a file name again until a valid file is entered. I hbelieve I have everything needed, but I cannot figure out how to write in the…
Write a program that will sequentially list numbers from 0 to 50, changing its color depending on the size of the number, for example, for numbers from 0 to 10 it will be green, 11 to 22 red and 23 to 35 blue, etc. Limit the screen output speed to about 1 character / second. In order to change colors, you must first use the GetStdHandle function to get a handle to the console, which is similar to getting a file pointer before working with a file. It is done e.g. as follows: HANDLE hConsole; hConsole = GetStdHandle (STD_OUTPUT_HANDLE); The above functions are defined in windows.h Tip 2: Write a utility to find out the colors corresponding to all combinations from 0 to 255. Tip 3: Instructions and sample program for working with time. C language plz with explanation of codes. thanks
Write a program that reads two input files whose lines are ordered by a key data field. Your program should merge these two files, writing an output file that contains all lines from both files ordered by the same key field. As an example, if two input files contain student names and grades for a particular class ordered by name (the key field), merge the information as shown below. File 1 and file 2 are supplied. Here is an algorithm to merge the data from two files: Read a line from each data file While the end of both files has not been reached While the end of both files has not been reached Write the line from file 1 to the output file and read a new line from file 1. Else Write the line from file 2 to the output file and read a new line from file 2. Write the remaining lines (if any) from file 1 to the output file. Write the remaining lines (if any) from file 2 to the output file. See the Merging Filesslides attachedto the project in Canvasfor a visual look at this algorithm.
1) Write a Java program to read a CSV (Comma separated values) text file. The text file will contain comma separated values in each line. There will be multiple lines with each line containing the same number of values. Ask the user to enter the path for the CSV file for reading the file. After reading the data from the file output the data to the console (one line at a time) with the data in each line in properly aligned columns. Then write the data to a serialized file called "credit.ser" to the local project folder . 2) In the second program, read the serialized file and output the data in columns to the console (one line at a time) with the data in each line in properly aligned columns.
Run a python program that will: a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence. b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt *** ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py *** Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala Thr
Write a C program that, given a text file, constructs Huffman code based on the character frequencies of the file and then encodes the file accordingly. The executable must accept the following command line options:• -i filename for the input file • -o filename for the output file Use the fread function, use FILE, size, etc. Please use the following to write the code: #include <stdio.h> #include <stdlib.h> #include <string.h> #include <getopt.h>
Write an automated censor program that reads in the text from a file andcreates a new file where all of the four-letter words have been replaced by11 **** 11• You can ignore punctuation, and you may assume that no wordsin the file are split across multiple lines.