Question

Explain which type of inheritance involves involve an affected male mating with an unaffected female resulting in all affected daughters but no affected sons. Include a sample pedigree AND a sample Punnett Square in your explanation.

 

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Example Genotype: AaBbCcDd on one chromosome (in cis); EeFfGgHh on another chromosome (in cis) Write...

A: The chromosome pairs that are of approximately same length, have same centromere position, and have ...

Q: Define dysentery, intoxication, and gastroenteritis. State how infection occurs in the GI tract.

A: The gastrointestinal tract is also known as alimentary canal or gut. It is an organ system inside th...

Q: How do we use genomic or cDNA libraries to find our gene of interest in a forward genetic screen?

A: Reverse genetics:It is an approach in molecular genetics. It is used to help in understanding the ro...

Q: What drugs have been associated with the development of drug-induced thrombocytopenia?

A: Platelets or thrombocytes are colorless blood cells, produced in the bone marrow to help blood clot....

Q: Please select all of the statements that apply to chlamydial infections.   (NOTE:  Please change all...

A: Chlamydia trachomatis:It is usually known as Chlamydia. It is gram-negative bacterium. It causes a s...

Q: Thymosin - For the hormone Thymosin (in humans) what is; 1. the origin (gland that secretes the horm...

A: Thymosins are small peptide hormones that are found in many animal tissues. It is secreted by the th...

Q: Can you please answer questions 1,2 and 3

A: Click to see the answer

Q: Why would heat production and body temperature and epinephrine and norepinephrine levels have an eff...

A: The body heat is maintained by balancing the heat loss and the heat produced by our body. The core t...

Q: Can you please answer 38, 39, and 40

A: We are authorized to answer one question at a time, since you have mentioned three questions, so we ...

Q: Enzymes are able to reduce the activation energy barrier in a number of ways. List at least three wa...

A: During a chemical reaction, substrates are converted into products. There is an intermediate state w...

Q: Metric

A: Metric system is a system of weights and measures. It is a decimal system of the measurement. It is ...

Q: In a non-evolving population of wildflowers, there are 452 individuals with serrated leaves and ther...

A: For every gene, there will be two alleles. One is dominant and the other is recessive and these two ...

Q: The portion of the diencephalon producing a "diurnal hormone" is the  a.epithalamus b.thalamus  c. h...

A: The correct option is a) epithalamus.

Q: give 2 examples of genera that produce endospores, and explain why they are important in human healt...

A: Endospore formation is the strategy of survival in gram-positive and gram-negative bacteria. It help...

Q: Microbiology-Discuss the various ways by which antibodies interact with antigen and facilitate antig...

A: The different types of interactions that mediate the destruction or inhibition of antigen are as fol...

Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged...

A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point ...

Q: Can you please answer 23, 24, and 25

A: Any alteration in the genome’s nucleotide sequence is called a mutation. Any agent that results in a...

Q: Why do small proteins have more difficulty folding and holding shape than larger proteins? If you we...

A: Protein folding is a physiological process by which a protein peptide chain acquires its native conf...

Q: What is the difference between male and female marchantia

A: Marchantia is a thalloid liverwort. It is usually seen as large colonies on damp surfaces. They are ...

Q: Which of the following would be part of the axial skeleton? 6. the frontal bone in the head a the ta...

A: Click to see the answer

Q: help me please

A: The natural selection is defined as the differential survival as well as the reproduction of individ...

Q: i am studying for my first test and a question came up that i cant make sense of. the question is "w...

A: The IVDs are intervertebral discs present between adjacently located vertebrae in the spinal column....

Q: A karyotype shows that a child has Klinefelter syndrome (47,XXY). If the child is also colorblind (d...

A: Karyotyping is the process of taking photographs of chromosomal pairs to determine the number of chr...

Q: If all the stem cells were removed from a holocrine gland, what effect will this have on long term f...

A: The holocrine glands are referred to as glands having holocrine secretion. Holocrine secretion is a ...

Q: An embolus is a blood clot that has broken loose and travels in the circulation. If an embolus lodge...

A: The lodging of an embolus, a blockage-causing piece of material, inside a blood vessel is referred t...

Q: List Koch's postulates and describe how this list supports the Germ Therory of Disease.

A: There are four postulates given by Robert Koch that allow the determination of causative microbial p...

Q: What is study of endocromology

A: Endocrinology is the branch of biology under which the endocrine system is studied. It includes the ...

Q: Why do some genes express themselves later in life? Why not earlier? How many chromosomes in a human...

A: Some genes are expressed later and not earlier:Gene expression is defined as the process by which th...

Q: what are the diffrences between bacteria and archea?

A: Archaea were categorized as bacteria initially, but biochemical studies found that they have strikin...

Q: Microbiology-Describe the physical or anatomical barriers at the following body sites, and explain h...

A: Since we are entitled to answer up to 3 sub-parts, we’ll answer the first 3 as you have not mentione...

Q: What are the components of  DNA and RNA, in detail, please.

A: Deoxy ribonucleic acid (DNA) and Ribo nucleic acid (RNA) are the genetic material present in most or...

Q: 11) Draw a bacterial expression vector with all required vector sequences. Be sure to label any spec...

A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to ...

Q: 12) Draw a yeast knockout cassette. Label all required sequence features.  a) Draw the target chromo...

A: Hi! As you have posted multiple questions and asked to provide with two knockout diagrams, we are pr...

Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T ACGC...

A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not mentione...

Q: explain the role of glutamine system in adjusting the blood PH

A: Glutamine is an amino acid which is used in protein synthesis. Glutamine plays an important role in ...

Q: The origin of the gluteus maximus is the_______. Lateral condyle Medial condyle Head of ...

A: Click to see the answer

Q: how is glucose reabsorbed in the proximal tubule?

A: The kidneys filter unwanted substances from the blood and produce urine to excrete them. There are t...

Q: Can you please answer questions 13,14, and 15 please

A: Answer for 13 Q:Proto-oncogene product causes stimulation of the cell cycle. Proto-oncogenes are nor...

Q: Explain what human structure is and the body plains

A: Click to see the answer

Q: Cell signaling in plant and animal cells is similar in some ways and different in others. What are s...

A: Cell signaling means cells present in organisms interact with surrounding and other cells for proper...

Q: Help for question 5

A: Given:At rest, the left ventricle of the heart pumps 5000ml of blood per minute and the renal blood ...

Q: What is lac operon? Draw and/or identify the status of the lac operon in a given set of environmenta...

A: The lac operon, otherwise called as lactose operon is an example of inducible operon. It consists of...

Q: Differentiate between axial region and perpendicular region

A: Click to see the answer

Q: Is this an example of positive or negative feedback?       A man is potty trainging his daughter. Wh...

A: Click to see the answer

Q: Microbiology-Describe the physical or anatomical barriers at the following body sites, and explain h...

A: Anatomical barriers:These are tough and intact barriers which prevent the entry and colonization of ...

Q: Describe how to activate (turn on) the GFP gene as well as the lac operon.  What are the functions o...

A: The GFP (green fluorescent protein) gene express a 238 amino acid long protein called green fluoresc...

Q: what is the normal temperature for a chicken?

A: Click to see the answer

Q: Which statement is false? 1. The reverse firing of neurons is linked to learning and memory2. The pl...

A: The nervous system is a complex part of the animal that is involved in coordinating the sensory info...

Q: Explain how novel properties of life emerge from complex organization.

A: The emergent properties are the properties that all rise in a system or in an organism as a whole. T...

Q: Why are anatomy and physiology studied together?

A: Anatomy, histology, physiology, and embryology are the branch of science that deals with the human b...