Q: Answer by listing only the name of the disease. Some questions will require the name of the…
A: Each disease has some specific symptoms that help doctors to determine the cause of the disease and…
Q: Put these in the right order of the body parts used during micturition (urination): urinary bladder…
A: The act of releasing urine from the bladder through the urethra is known as micturition, commonly…
Q: Question 8 Calcitonin is secreted by the muscle Clear (C) Owhite adipose cells in the thyroid gland.…
A: Calcitonin is a hormone that helps to regulate calcium levels in the body. It is produced and…
Q: Normally, a tRNA with the anticodon 3'-UUA-5' would be connected to which amino acid? Asn Oleu Asp…
A: T-RNA resembles a clover leaf or an inverted L in form. It contains complimentary nucleotides to…
Q: Directions: Use the cladogram below to answer the questions on this worksheet. C. Sharks D.…
A: A cladogram is a diagram that represents the evolutionary relationships between different groups of…
Q: The structure of the eye than can change shape to focus light rays on the fovea centralis is the…
A: The structure of the eye is a complex arrangement of specialized tissues and organs that work…
Q: Drug continuum worksheets
A: The worksheet shows how someone goes from using a substance to stopping completely. At each point,…
Q: Give typing answer with explanation and conclusion Discuss health teaching information relevant to…
A: Diabetes, also known as diabetes mellitus, is a long-term metabolic illness that affects how your…
Q: QUESTION 6 Populations at risk for vitamin D deficiency include: (must select correct populations…
A: Vitamin D is nutrients which is very important for our body. Our body need this nutrients to…
Q: Review the biome shown in the illustration below. What biotic factor contributes to the…
A: The question is centered around a specific biome characterized by various features, such as diverse…
Q: Which cultures would be suitable for the transduction experiment and why? Which cultures would not…
A: Transduction is a process of gene transfer in bacteria, where bacterial DNA is transferred from one…
Q: Which of the following are parts of cardiac muscle O Dense bodies and sarcolemma OZ discs, triads,…
A: Cardiac muscle is a type of muscle tissue that forms the heart. It is a specialized type of…
Q: Alcobiosis, an algal‑fungal association on the threshold of lichenisation 1. What two organisms are…
A: Lichens are composite organisms consisting of a mutualistic association between a fungus and a…
Q: What does an onion cell look like at Telophase (400x)?
A: Telophase is the final stage of mitosis, the process of cell division, in which the duplicated…
Q: Based on your updated mode of inheritance, the team asks you to do some probability…
A: This pedigree is following X linked inheritance pattern. In this kind of inheritance pattern…
Q: Summary table of data for one yeast DNA microarray. Shows 14 of the 6,200 genes on the full…
A: A DNA microarray also known as a DNA chip or gene chip is a high throughput technology used to study…
Q: What are the symptoms of intoxication as well as withdrawal symptoms that come with heroin abuse?
A: Heroin is a black, sticky ooze or a white, brown, or brown powder. It is an opioid medication…
Q: scuss the impact of the process on society. 6,The end of your paper should include your opinion or…
A: Lactose intolerance is a condition in which the body is unable to fully digest lactose, a sugar…
Q: A starting population of 300 individuals grows by 33% every year. Assuming that resources are…
A: Here, we use the following formula ; P = P0 (1 + r)t where P = population after time 't' P0 =…
Q: The lungs have a Pco2 of 40 mmHg. Which of the following Pcoz levels would cause carbon dioxide to…
A: Gas exchange is a vital process that occurs in the respiratory system and allows oxygen to be taken…
Q: Identification of Indep and Dep Var
A: During graph plotting we generally have two sets or groups of values, each group called a variable.…
Q: Which of the following is true about a test cross? It is used to determine the genotype of an…
A: The genotype of an individual is their own genetic pattern. The two alleles that an individual has…
Q: One such neurotoxin, Sarin (chemical name: propan-2-yl methylphosphonofluoridate) is considered a…
A: Neurotransmitters are chemicals that are produced by neurons to transmit signals across synapses to…
Q: Remaining Time: 43 minutes, 54 seconds. * Question Completion Status: QUESTION 1 One difference…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Table 1- Comparison of the effect of catechol concentration on the amount of product formed.…
A: Enzymatic reactions refer to chemical reactions that are facilitated or catalyzed by enzymes.…
Q: For flower color A-bb results in red, aaB- results in blue and A-B- results in purple. There is also…
A: The type of variation present at a certain locus in the genome is scored by what is known as a…
Q: Which process is illustrated in the diagram? NAA 5' Replication Transcription RNA processing…
A: Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the majority of other…
Q: Identify what microorganisms are in each of the 10 plates from studying the gram stain and agar…
A: Plate-1 The organism appears purple in the Gram staining. So, the organism is Gram-positive. The…
Q: Can you draw a prokaryotic heterotrophic electron transport chain?
A: The process of cellular respiration involves the oxidation of biological fuels in the presence of an…
Q: The same lab tested Prince Harry and Megan Markle. They confirmed that Harry does have hemophilia,…
A: Hemophilia is a genetic disorder that affects the blood's ability to clot normally. People with…
Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…
A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…
Q: Reflection for understand the four C’s of addiction?
A: Addiction is a complex and chronic brain disease that is characterized by the compulsive and…
Q: At the end of the procedure, what do you do with the cloudy, stringy mass of DNA in order to observe…
A: Here, B) Quickly centrifuging the DNA is the right answer. Depending on the technique of observation…
Q: 4. How do antibodies work in the immune system? eiers bus shished igaul 292 stab to agil 127l er
A: The immune system is a complex network of cells, tissues, and organs that work together to protect…
Q: Which of the following statements is not true? a. Some RCTs may involve "cross-over" as part of…
A: Randomized controlled trials (RCTs) are a type of study design that is commonly used in medical…
Q: Organism that cannot produce it’s own nutrients and gets them by feeding on other organisms or their…
A: Nutrients are substances that are essential for the growth, development and maintenance of living…
Q: The Importance of the Cell in Human Health
A: Cell is the smallest living part of an animal and plants. Two different types of cells are ---…
Q: Below is shown a recombination intermediate between two non-sister chromatids (both strands of the…
A: Two homologous non-sister chromatids pair up with each other and exchange different segments of DNA…
Q: Match the individuals in the following pedigree to genotypes B DDDDD..... + + C Mode of inheritance…
A: The study of a specific trait that is passed down from one generation to the next is called pedigree…
Q: A severe winterkill seemingly killed all the trout in a lake. A decision is made to restock the lake…
A: The formula to calculate the number of trout in the lake after a certain number of years is: N = K /…
Q: Compare and contrast procedures for preparing and observing live and fixed stained cells.
A: Preparing and observing live and fixed stained cells are two common procedures in cell biology that…
Q: ASSIGNMENT UCTIONS AND INFORMATION This assignment consists of five tasks from which you must ch…
A: Note: According to bartleby guidelines only first question is to be answered. Smoking a cigarette…
Q: Name the two overarching phases of the cell cycle? How long does the complete cell cycle take in…
A: Here we'll explore the basic of the cell cycle, which is an essential process that permits cells to…
Q: Name two cell functions regulated by DAG and IP3
A: The majority of chemicals that cause cell signalling are those that attach to a particular protein…
Q: Catalase is an enzyme responsible to toxify; H₂O2 toxify; H₂O detoxify; H₂O2 detoxify; H₂O from…
A: Enzymes are biocatalyst that perform specific biochemical reaction inside of the living organisms.…
Q: 1 The graph in Figure 32.5 shows a logistic growth curve. Population size->> 2 Time- FIGURE 32.5…
A: Population is one of level of ecological organisation which is composed of numerous individuals.…
Q: Gene expression is regulated by a combination of_ enhancers and ORI enhancers, repressors and…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Gametophytes of ____ plants form protected inside reproductive parts on a sporophyte body.…
A: Gametophyte is the haploid phase in the life cycle of plants and algae that produces gametes through…
Q: Identify the correct recognition site for ribosome subunit binding during transcription. A. the 40s…
A: Transcription is the synthesis of mRNA from a DNA template which occurs in 5'-3' direction.During…
Step by step
Solved in 3 steps
- Explain the importance of different temperatures in PCR.Tm of forward primer= 62 °CTm of reverse primer= 59 °CGene size= 3 KbWhat are some of the observations and conclusions that can be made from gel bands for 16s PCRIn PCR amplification Why is it important to know the length of the sequence you amplify?
- Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.Calculate the volume (in µL) of DNA template required to add 60.0 ng to a 40.0 µL PCR if the DNA template is at a concentration of 28.0 ng µL-1.What can one do if the annealing temperature was programmed to 65 degrees celcius instead of 50 degrees celcius on the thermocycler during PCR and how would this effect the PCR
- What enzymes and structural proteins are not needed in the PCR reaction tube that are needed in living cells in order to copy DNA? Give a brief reason for why each of these proteins is not needed in a PCR reaction tube.From a single DNA molecule, calculate how many copies would be produced in 12 cycles of pcrChoose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
- anatomical distribution of gene expression can assessedby...... in situ hybridization rnai nortbern blotting genOmic pcrBriefly explain the rationales of adding Bisacridine A which can affect DNA stability in polymerase chain reaction (PCR).Run a barcoding protocol with rbcL gene-specific primers. Use 30 cycles for your PCR amplification profile. Complete the table below for your PCR cocktail.