For questions 3–7, match each organ system with one of the followingfunctions.a. regulates other organ systemsb. removes waste products from the blood; maintains water balancec. regulates temperature; reduces water loss; provides protectiond. removes foreign substances from the blood; combats disease;maintains tissue fluid balancee. produces movement; maintains posture; produces body heat3. Endocrine system4. Integumentary system5. Muscular system6. Nervous system7. Urinary system

Q: Describe the basic structure of ribosomes in bacterial and in eukaryotic cells

A: Ribosomes  found within the cytoplasm or bound to the endoplasmic reticulum. The main function of th...

Q: Define phalange; pl. phalanges

A: Phalanges are the bones present in the finger and toes. There are a total of 56 phalanges present in...

Q: describe the rise in calcium in the sarcoplasm can lead to skeletal muscle contraction Don't copy ...

A: The muscular system in our body plays an important role in producing movements The mobility of the b...

Q: Define hypoxia

A: HYPOXIA : hypoxia is a condition in which the body or a region of the body is deprived of adequate o...

Q: Define lymphatic system

A: Lymph: A transparent or pale-white fluid circulated in the lymphatic system is lymph.  Extracellular...

Q: Define isometric

A: The skeletal system is the entire framework of bones and their cartilages, along with the ligaments ...

Q: Define podocytes

A: The bowman’s capsule or the glomerular capsule is the expanded end of the renal tubule; It encloses ...

Q: Between breaths at the end of an unforced expiration, in whatdirections do the lungs and chest wall ...

A: Breathing is the process in which air moves into and out of the lungs. It has two phases that are in...

Q: Define vulva

A: The female reproductive system is made up of the internal and external sex organs that function in r...

Q: Define pressoreceptor

A: The cardiovascular system is also called the blood vascular or circulatory system, consists of a mus...

Q: Define loop of Henle

A: There are several kinds of nitrogenous waste produced by animals because of the different kinds of c...

Q: Define pronephros

A: The urinary system is composed of a pair of kidneys, a pair of ureters, the urinary bladder, and a u...

Q: What major organelles make upanimal cells?

A: Cells are chamber-like structures containing jelly resembling cytoplasm which is enclosed by boundar...

Q: Define vascular tunic

A: Eye is the organ related to sight.

Q: Describe how a neuron is affected by MS. Then, describe the physiological mechanisms by which MS can...

A: Affect of multiple sclerosis on neuron  : in multiple sclerosis , nerve cells or neurons are damaged...

Q: 2. which part of the cell at left doe the light purple at arrow # 1 represent

A: Sperm is a male reproductive cell. It is formed in the male reproductive organ known as testicles. S...

Q: What are the similarities and differences between DNA and RNA?  What is base pairing?

A: DNA is a complex structure that consists of two strands wound around each other to form a double-hel...

Q: Define jejunum

A: The digestive system involves the network of all organs that turn food into energy and eliminate was...

Q: Define interatrial septum

A: Heart is situated in the thoracic cavity in between the two lungs and slightly tilted to the left lu...

Q: Track a glucose monomer of a starch molecule through the body. Include the names of all anatomical p...

A: The circulatory system involves the circulation and pumping of the blood with oxygen from the heart ...

Q: Name any 2 tissues involved in upper respiratory tract and where exactly

A: The respiratory system is one of the 11 organ systems working in the human body. This system involve...

Q: Define hypokalemia

A: Blood is a constantly circulating liquid providing the body with nutrition, oxygen and waste expulsi...

Q: 3: You also tended to a verbose and flamboyantly dressed zookeeper who came in with a gun strapped t...

A: Hemorrhagic shock is a medical condition triggered by a drop in blood volume (hypovolemia), which ty...

Q: Identify typical V̇O2 max values for various sedentary, active, and athletic populations.

A: The respiratory system is a biological system responsible for gas exchange in our body. It consists ...

Q: Define countercurrent

A: Anything that flows is a fluid. 

Q: Define lipoprotein

A: Since lipids, such as cholesterol and triglycerides, are insoluble in water, they must be transporte...

Q: Define heme

A: Heme, or haem, is a precursor to haemoglobin, a protein that binds oxygen in the bloodstream. Both t...

Q: Define hematoma

A: The cardiovascular system consists of the heart, the blood vessels, and most importantly, the blood....

Q: Define somatomedin

A: Proteins are large biomolecules that are made up of one or more long chains of amino acid residues. ...

Q: Define multipolar neuron

A: The fundamental units of the brain and nervous system carrying electrical impulses is called as neur...

Q: Define autoimmune disease

A:  An immune response is a reaction that takes place within an organism to protect it from foreign inv...

Q: Define kilocalorie (kcal)

A: According to nutritional biology, one kilocalorie is equal to a thousand calories. Calories are the ...

Q: Define somatic

A: Every cell in the body except germ cell (cells that grow into gametes), or stem cell is referred to ...

Q: Define prostatic urethra

A: The urethra can be defined as the vessel which transports urine from the urinary bladder to the open...

Q: Identify the basic tissue shown in this image

A: The skeletal muscles are also known as striated muscles. The skeletal muscles are one type of major ...

Q: Place the following concepts in the correct order to explain how a reflex works: Target organs , Aff...

A: We sometime experience a sudden withdrawal of a body part which comes in contact with objects that a...

Q: Define hyposmotic

A: Diffusion is the random movement of molecules along the concentration gradient (from higher concentr...

Q: the blue arrow is pointing to the region called ?

A: Embryogenesis is defined as the type of sequential dynamic process where the embryo of the animal de...

Q: Define parietal pleura

A: A tissue is a group of structurally and functionally similar cells that  carry out specialized activ...

Q: Define olfaction

A: The sense of smell (odour) is also referred as olfaction. It involves the detection of sense chemica...

Q: Define nucleus; pl. nuclei

A: The nucleus is a membrane-bound organelle that contains genetic material (DNA) of eukaryotic organis...

Q: Define involuntary

A: Involuntary term means the thing or an action which is not under our control. There are voluntary as...

Q: Define vestibular membrane

A: The ear is the center of hearing. It consists of ear bones, a tympanic cavity, and an eardrum. There...

Q: Define internal naris; pl. nares

A: Naris is the Latin singular of nares and has a lower medical use than nares. They are the nose's hol...

Q: Identify the vein labeled A

A: Vein- It is one of the two types of blood vessels present in the body. Veins carry deoxygenated bloo...

Q: Which of these vessels labelled “A” and “B” is an artery

A: An important component of the circulatory system is found to be blood vessels. They perform the tran...

Q: Identify the bones labelled “A” and “B” respectively

A: The skeletal muscles, aid in the movement and locomotion of an organism. The mineralized connective ...

Q: 1 20 ORI 40 60 3' TTCGAGCTCTCGTCGTCGAĠATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAGCAGCTCT...

A: The first five amino acids encoded by the gene are : thymine thymine cytosine guanine  adenosine

Q: Define chondrocyte

A: Chondrocyte presents a unique cell type in articular cartilage tissue and is required for cartilage ...

Q: Define Purkinje fiber

A: The Purkinje fibers are present in the inner walls of the ventricles. These cardiac muscle cells are...