Gas exchange occurs in which part of the respiratory system? Select ALL correct answers: O Alveoli Trachea Bronchi Bronchioles

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...

Q: A cation channel blocker is injected into a single olfactory neuron in a rat. When exposed to the co...

A: Olfactory neurons are bipolar neurons adapted for peripheral odorant signal transduction and transmi...

Q: Science Pd Plant Parts Plants are A Vascular DAutotrophs ©Heterotrophs 2. What can vascular plants d...

A: Introduction :- A heterotroph is an organism that obtains energy and nutrients from other plants or ...

Q: Question 11. Why would a slowly evolving gene have limited utility in dating recent divergences? Que...

A: Answer 1: A slowly evolving gene have limited utility in dating recent divergence because they won't...

Q: Assuming the line is not perfect, what are some sources of error?  If you state ‘human error’ be spe...

A: With the help of Spectrophotometric analysis , we are able to calculate the concentration of a subst...

Q: Energy is stored long-term in the bonds of used short-term to perform work from a(n) molecule. and a...

A: Adenosine triphosphate (ATP) is the energy currency of all living cells. Cells need ATP molecules to...

Q: How does the increase in the influx of tourists affect the ecosystem of the city?

A: Increase in Tourism/Influx of Tourists negatively implacts  Environmental conditions in that particu...

Q: After a long excursion in the tropics you came back  with multiple soil samples from different local...

A: ISOLATION OF ANTIBIOTIC PRODUCING FUNGI FROM DIFFERENT SOIL SAMPLE:  1.COLLECTION OF SAMLPLE:  soil ...

Q: 1. Compare your average heart rate, respiratory rate, and temperature in the "Before exercising" row...

A: 1..  Before exercise Body temperature is normal (37 degree C) Respiratory rate is 15 times per minut...

Q: non-cancer risk

A: Cancer is a disease in which abnormal cells divide uncontrollably and destroy body tissue.

Q: Fill in the blanks. Reard carefully and choose your answer inside the box. Please write your answer ...

A: The tissues, glands, and organs involved in producing offspring in the females is known as the femal...

Q: What factor(s) may have influenced the decrease in the number of deaths from cholera up until the ti...

A: * Terrible outbreak of cholera took place in braod Street of london. *  John snow is anesthesiologis...

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction A cell's ability to receive, process, and transmit messages with its surroundings and w...

Q: May I ask is there a way to identify the working environment with toxic gas concentrations exceeding...

A: The most common hazardous gases encountered in confined areas are Volatile Organic Compounds (ppm VO...

Q: 1. IDENTIFY THE LINING. 2. IDENTIFY THE ORGAN. 3. IDENTIFY THE SPECIAL STRUCTURE.

A: This diagram is of the mucus layer, which we can clearly identify as we can see in the image 3 layer...

Q: Who's is the father of cell biology? And give a little history about him

A: Cell is present in all organism and is a chief elemental unit of the body which is site for various ...

Q: MULTIPLE CHOICE Which of the following nucleotides are found in RNA? Select all that apply. A adenin...

A: Given: Nucleic acid is composed of nitrogenous bases, pentose sugar and phosphates. DNA and RNA are ...

Q: Biologists produced the karyotype of a different parrot in Africa that had 2n = 62. Using the inform...

A: A typical African parrot has a karyotype containing 2n = 62-64 chromosomes with 8 pairs of macrochro...

Q: Questions: 1- Name the different type of dialyzers. 2- What is relationship between hollow fiber por...

A: 1... Types of dialyzers cellulose triacetate (CTA), ethylene-vinyl alcohol co-polymer (EVOH), polyes...

Q: Why do infants experience emotions?

A: Emotion is defined as a complex experience of consciousness, bodily sensation, and behaviour that re...

Q: Cat ovary region? structure? layer? region? * Region: cortex or medulla

A: Above region is Cortex..   Lower region is medulla  

Q: In many viral diseases (e.g., smallpox, mumps and influenza), illness occurs shortly after exposure ...

A: A virus is a combination of hereditary code, either DNA (deoxyribonucleic acid) or RNA (ribonucleic ...

Q: In one statement maximum, explain what a hypertonic solution is in reference to solute concentration...

A: Based on the concentration of solute molecules present there are three types of solutions: 1. Hypoto...

Q: Identify the differences between a prokaryotic and a eukaryotic cell. Discuss the structures found i...

A: A cell is the basic unit of life. A cell is made up of a liquid portion called the cytoplasm, which ...

Q: In horses, the coat color black is dominant (B) over chestnut (b). The trotting gait is dominant (T)...

A: A dihybrid cross is a cross in which two traits are involved. As per the question , two traits are ...

Q: g best describes the complete sequence of steps occurring during every cycle of PCR? I-The primers h...

A: A laboratory method used to make many copies of a specific piece of DNA from a sample that contains ...

Q: Identify the pointed structures.

A: Connective Tissue is those tissues that support and protect the tissues and organs of the body. Some...

Q: A. Observation of growth characteristics on selective and differential media Mannitol salt Agar Bact...

A: S.aureus stands for staphylococcus aureus. If we are to grow this bacteria in Mannitol salt agar med...

Q: 7. Draw what you would expect to see for acid fast stain and endospore stain procedure if you did no...

A: Staining is a technique for adding color to cells, tissues, or microscopic components so that they c...

Q: 3. Someone in your office has the flu. How would the social habits of your office cause other people...

A: INTRODUCTION Answer of question number 3 is given below.

Q: Fruit flies (Drosophila) were mated. Cross #1 - 2 male red eyes (se+), wild wings(ap+) X 4 female r...

A: The Dihybrid cross is a crossing between two organisms, being heterozygous to two different traits. ...

Q: Today, it is easy to make transgenic plants and animals. What are some important  safety and ethical...

A: Recombinant DNA technology  Insertion of desired foreign DNA in an organism. 

Q: While performing a routine protein crystallization screening, you observe that one of your well drop...

A: Introduction The drop on the elevated platform, which is usually 2–10 µl, consists of half stock pro...

Q: If Photosystem I is inhibited, will H+ still be pumped into the thylakoid space? O No, because the e...

A: When an electron leaves PSII, it is transferred first to a small organic molecule (plastoquinone, Pq...

Q: • 1. Identify the tissue. • 2. Identify the structures pointed by letter "A." • 3. Identify the stru...

A: The group of cells which function together and have same structure are called as tissues.

Q: in ur own words What are some symptoms of PCS (post-concussion syndrome) and what makes it more like...

A:

Q: 1. IDENTIFY THE EPITHELIUM. 2. IDENTIFY THE ORGAN. 1. 2.

A: The epithelium is the lining in the hollow organs and body cavities, or covers the internal and exte...

Q: A scientist studying a species of algae, Gracilaria domingensis, discovered that its color is contro...

A: Alleles can be described as the different forms associated with particular gene. The formation of ge...

Q: Give the importance of the a) water cycle b) nitrogen cycle

A: Ecological cycles are the self-regulating mechanisms that recycle the earth's limited resources — wa...

Q: Write the sequence of the a. Gas pathway b. Gai pathway Name at least 3 second messeng

A: Gas pathway: Flux through the glyoxylate shunt, as well as anaplerotic processes for pyruvate oxidat...

Q: Interpret the given cladogram:

A: An evolutionary tree that diagrams the ancestral relationships among organisms is known as the clado...

Q: Define Chronic Bronchitis: ( 1pt) What makes a condition chronic? (1pt) COPD is the abbreviation for...

A: chronic bronchitis :-- it is a lung condition that develops over time in which the bronchi which is ...

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-...

A: The X-ray diffraction is one of the analytical techniques in which the X-rays are used for analysis ...

Q: Q6. This figure shows the sequence alignment of five (5) different Src homology 2 (SH2) domains, all...

A: sequence alingment  is the method of comparing the similarities between the biological sequences pre...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: Classify each example under the following characteristics of life (1) gathering and using energy, ...

A: Introduction Regardless of complexity, structure, habitat, or other factors, all living things on Ea...

Q: phylogenetic tree

A: A phylogenetic tree is a branching diagram or a tree showing the evolutionary relationships among va...

Q: Build a frame with at least 4 components which represent a domain for insects

A: Insects are distinguished from other arthropods by their body, which is divided into three major reg...

Q: Your client, Robert, came back from maximal graded exercise testing and told you that his clinical e...

A: Introduction: The greatest rate of oxygen consumption measured during incremental activity, that is,...

Q: Complete the energy pyramid by writing the source of the energy for the food web and how much energy...

A: Introduction An organism's trophic level is the position it holds in a food chain. A food chain is a...