The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter11: Genome Alterations: Mutation And Epigenetics
Section: Chapter Questions
Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...
Related questions
Topic Video
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution!
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning