Answered: II only

Science

Biology

II only

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter16: Gastrointestinal Drugs

Section: Chapter Questions

Problem 6CRQ

See similar textbooks

Related questions

Q: One objection many people have about vaccinations is the amount and variety of chemicals in them.…

A: Vaccination is a simple, safe and effective way of protecting you against harmful diseases. It uses…

Q: Match the system to its speed of message transmission and the type of message it sends. Hormones…

A: Nervous sysem send impulses in very few second. Transmission speed is very fast. But response is…

Q: Can you pls go into more detail regarding the growth regulators and how it works.

A: Plant Growth regulator(also known as plant hormones) are a group of chemical compounds that have a…

Q: Indicate whether each of the following statements is true (T) or false (F). a. An unsubstantiated…

A: A virus is an infectious microbe consisting of a segment of nucleic acid (either DNA or RNA)…

Q: QUESTION 1 Loci Recombination Frequency (%) L and M 50 L and N 19 L and O L and P 50 50 M and N 50 M…

A: The test cross is done to find the genetic map. The crossing of unknown parent is done wit…

Q: Gestation takes about -____weeks. a) 38-42 b) 44-46 c) 28-30 O d) 48-52

Q: The most likely site for food contamination is: a) a person's own kitchen O b) the grocery store c)…

A: Introduction Food contamination:- It refers to food that has been corrupted with another substance –…

Q: CLASSIFICATION EXAMPLES FEATURES Domain Archaea Kingdom Phylum Class Order Family Genus Species…

A: Classificiation can be defined as a arrangemant of taxa on the basis of certain observed…

Q: 2. Consider genes that have 2 alleles each. Gene 1 has allele "E" and "e", where E is dominant to e.…

A: A dihybrid test cross is a cross between a double heterozygous individual and a double homozygous…

Q: cells are part of an organ in the digestive system. Use evidence to explain how the intestinal cells…

A: Human digestive system chiefly consist of gastrointestinal tract and associated glands.The process…

Q: 2. Consider the following paragraph from a peer-reviewed publication detailing the extraction and…

A: Lectins These are defined as glycoproteins. They have the ability to make bonds with carbohydrates…

Q: 2. Next, use the Hardy-Weinberg equation (p + 2pg + g = 1) to calculate the expected frequencies of…

Q: When is sterilization by filtration preferred over sterilization by heat? Why? What makes heat an…

A: Answer :- 1)Filteration is the sterilization process wherein there is the physical removal of…

Q: Identify two ways in which the immune responses in gut mucosal tissues contrast with those initiated…

A: Mucosal tissues are found in the body as plasma cells, which are mostly found on epithelial…

Q: Consider the similarities and differences in the cell cycles (mitosis and meiosis) of plants and…

A: Mitosis and Meiosis similarity 1. Both occur during cell reproduction. 2. Both occur in stages.…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: Transcription Formation of RNA over DNA template is called transcription. Translation The process…

Q: What is seed dormancy? Why is it good?

A: ANSWER;- Seed dormancy;- Seed dormancy is a transformative adaptation that keeps seeds from…

Q: Question: For bacterial gene transfer via conjugation to occur, the host bacterium must possess a…

A: The conjugation of the bacteria plasmids is called bacterial conjugation and in this here is direct…

Q: A maternal effect gene in Drosophila, called torso, is found as a recessive allele that prevents the…

A: Introduction The relationship between two variants of a gene is referred to as dominant. Each parent…

Q: Primary and tertiary structure influence the function of enzyme uniprotkb-p39086

A: enzyme "uniprotkb-p39086" is the uniprot id for the enzyme glutamate receptor. Glutamate ionotropic…

Q: 6. In man, normal color vision vs red-green color blindness is controlled by the allelic gene C…

A: The colorblind trait is encoded by genes present on the X chromosome. It is a kind of recessive…

Q: Young tropic birds tend to accumulate fat that they then must lose prior to their first flight. Why

A: Bird flight is the essential method of locomotion involved by most bird species in which birds take…

Q: Air sae connection with humerus bone Branchus Humenus bone -Heart 7 Tsil

A: INTRODUCTION The respiratory device is one of the most important structures of the body. It has a…

Q: For this statement, answer True or False and explain your answer briefly. In the precipitin test of…

A: Precipitin test is a simple serological technique that shows the precipitin reaction in solution.…

Q: What kind of membrane proteins trigger a change in cellular activity in response to a stimulus?

A: Introduction:- Membrane proteins are embedded in lipid bilayer and perform many functions important…

Q: The elderly tend to have difficultly absorbing vitamin A with age. O a) True b) False

A: Vitamins are the organic compounds which are required by our body in small amounts for maintaining…

Q: The probability of having an individual recessive for all gene pairs from the cross Aabb x aaBb is O…

A: This is a case of dihybrid cross because there are involved two genes. These genes are A and B.

Q: Which statement of the cell theory is connected to an understanding of meiosis? Cells are the basic…

Q: Please help explain Angiotensin-converting enzyme 2 (ACE2) is a receptor for cell entry of…

A: Angiotensin II converting enzyme has the main role of degradation of Angiotensin II. It is the main…

Q: Name and describe the two forms of energy and provide an example of each.

A: According to science , energy is the quantitative attribute that must be transmitted to a body or…

Q: The enzyme armylase digests.

A: Amylase is an enzyme made up of protein. It is specific with its substrate and its substrate is…

Q: owl, barring (B) is sex linked and dominant recessive allele (b) producing solid black color when…

A: Sex linked Allele is present on the sex chromosome that is usually on the X chromosome. Autosomal…

Q: It is necessary to develop a string matching method that may be used to compare two or more…

A: To determine patterns over sequences and to determine different matching pattern we use string…

Q: To determine: The effect of calcitonin on blood calcium levels when the release of this hormone is…

A: In biology, homeostasis refers to the state of consistent internal, physical, and chemical…

Q: What is the hazard of the splattering tendency in flame sterilizing an inoculating loop? Can…

A: Aseptic preparation of culture media :-

Q: What are the three phases of seed development? When does the peak of ABA concentration take place?…

A: Seed is defined as an embryo, which is an immature diploid sporophyte developing from the zygote,…

Q: Explain why it is necessary that DNA is replicated continuously on the leading strand by but…

A: Introduction : Direction of DNA replication is 5' - 3' . Primase add primer and DNA polymerase…

Q: Using the data gathered by the instructor from other students in University, calculate the…

A: Given information Free-hanging earlobes (F) is dominant Attached earlobes (f) is recessive Total…

Q: Consider a diploid organism that follows the XX-XO mode of sex determination. Normally, there are 7…

A: Given data, Number of chromosomes present = 7 Chromosome I = large acrocentric chromosome…

Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…

A: Nitrogen-fixing prokaryotes microbes are capable of converting nitrogen gas from the atmosphere into…

Q: 1. Use the observed genotype frequencies from Day 7 data to calculate the frequencies of the C…

A: Hardy Weinberg equilibrium is present when population is of large size and random mating is present…

Q: 71. The scolex of T.saginata has: I. 4 suckers II. 2 suckers ad 14 hooklets III. 26-28 sucking discs…

A: The scolex of T.saginata has:

Q: Quarter Activity 4 Instructions Instructions Direction: Answer the following questions in paragraph…

A: 1) Body system: A collection of parts able to work together to serve a common purpose- growth,…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: Describe the probable root system of a crop that has been applied with frequent and light

A: Given: Need to describe the probable root system of crop that must be applied Frequently and in…

Q: In the Middle Ages, during massive plague epidemic, one of the control measures instituted was the…

A: During the late Middle Ages and early Renaissance (1350-1450) the bubonic plague, also called the…

Q: What is the phylogenetic relationship between Homo heidelbergensis, H. sapiens, and H.…

A: Homo heidelbergensis began to develop regional differences that eventually gave rise to two species…

Q: NO EXPANSION NEEDED, ANSWER ONLY. 11. Oocyst of Toxoplasma is found in: a. human tissue b. the brain…

A: INTRODUCTION Answers of question 11-13 is given below.

Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…

A: Answer--- Nitrogen fixing bacteria are organisms that are able to convert atmospheric nitrogen into…

Q: What type of food did hominins prefer..salty spicy ?

A: Introduction The Hominini are a taxonomic tribe under the Homininae subfamily. Hominini includes the…

Question

NO EXPLANATION NEEDED, LETTER OF THE ANSWER ONLY. 17.Geophagia may be seen in heavy infection with a. A. lumbricoides b. N. americanus c. A. braziliense d. T. trichuria e. Two of the above 18. Which is not a pathologic effect of helminthinfections: I. Diarrhea II. Hemorrhage III. Enlargement of organs a. I only b. I and II only c. II only d. I and III only 19. Hypochromic microcytic anemia: a. Hookworm b. Whipworm c. Pinworm d. Threadworm e. Two of the above 20. A male roundworm is differentiated from a female roundworm by a (an): a. pointed posterior end b. anterior buccal capsule c. dorsal curved posterior end d. closed buccal capsule e. anterior closed buccal capsule

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The bubo of bubonic plague is a/an a. ulcer where the fl ea bite occurred b. granuloma in the skin c. enlarged lymph node d. infected sebaceous gland
Necrotizing ulcerative gingivitis is a _____________ infection.a. contagious b. mixed c. spirocheted. systemic
. Although rotavirus diarrhea incidence declined after the event of the previous question, the blue line shows there are still cases of severe diarrhea in following years (although not as many) These cases A. could be due to norovirus or bacterial pathogens. B. must all be caused by rotavirus. C. are probably not severe.
The treatment of choice for syphilis isa. chloramphenicol b. antiserum c. penicillind. sulfa drugs
a. If a person returns from traveling afflicted with trypanosomiasisor leishmaniasis, is he or she generally infective to others?Explain.b. Explain why there is no malaria above 6,000 feet in altitude.c. Account for all of the protective effects offered by insecticidetreatedbednets.
A complication/complications of typhoid fever is/area. neurological damage b. intestinal perforation c. liver abscesses d. b and c
Adenoviruses are the agents ofa. hemorrhagic cystitis b. keratoconjunctivitis c. common cold d. all of these
Which of the following is true of the chancre observed dur-ing primary syphilis?(a) It disappears and leaves a scar.(b) It lasts throughout all stages of syphilis.(c) It is usually found on the face.(d) It is a hard, painless, lesion.(e) It is painful and purulent.
Which statement concerning cholangitis is correct() A) The most common infecting organism is Staphylococcus aureus B) The diagnosis is suggested by the Charcot triad C) The disease occurs primarily in young, immunocompromised patients D) Cholecystostomy is the procedure of choice in affected patients E) Surgery is indicated once the diagnosis of cholangitis is made
Type of infection for the following and small info about them: E. Balantidiasis F. Sleeping sickness. G. Toxoplasmosis
NEED ASAP THANKSSSS Which of the following(s) are true about granulomatous amebic infection of the brain? Can present as subacute or chronic encephalitis. Spinal cord is typically involved. Can present as a space-occupying lesion. Do not have cyst formation. a. 1, 2, and 3 are true b. 2 and 4 are true. c. 1 and 3 are true. d. Only 4 is true. e. None of the above
Relapsing fever is spread bya. lice b. ticks c. animal urine d. a and b