need correct answer please 5. Given the following DNA sequences for cytochrome c, answer the question below.AmoebaCatSharkDolphinATTAGCGACCAGTTTATCCTACAATCCCGTCTACTT CATcat and kangarooTTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGTamoeba and catCTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGTKangaroo CTAATCCCCCCGTTTATCCTAСТТТСССАТСТАСТАAGTCTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGTLooking at the given DNA sequences for cytochrome c, which two organisms are the most closely related?shark and dolphinkangaroo and dolphin

Below are given DNA sequences. These DNA sequences will form a triplet code which would ultimately…

Given the following DNA sequences for cytochrome c, answer the question below. Amoeba Cat Shark Dolphin ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTT CAT TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Kangaroo CТAATCCCCCCGTTTAТССТАСТТТСССАTCTACTAAGT Looking at the given DNA sequences for cytochrome c, which two organisms are the most closely related? O shark and dolphin O cat and kangaroo O amoeba and cat O kangaroo and dolphin

Given the following DNA sequences for cytochrome c, answer the question below. Amoeba Cat Shark Dolphin ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTT CAT TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Kangaroo CТAATCCCCCCGTTTAТССТАСТТТСССАTCTACTAAGT Looking at the given DNA sequences for cytochrome c, which two organisms are the most closely related? O shark and dolphin O cat and kangaroo O amoeba and cat O kangaroo and dolphin

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter25: The Origin Of Life

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

Peptidoglycan is a chemical compound found in the cell walls of (a) most viroids (b) most archaea (c) all prokaryotes (d) most bacteria (e) most eukarya
The yeasts whose fermentation reactions produce the carbon dioxide that makes bread rise are a type of _____. a. chytrid b. zygote fungus c. sac fungus d. club fungus
Cyanobacteria harness energy from the sun through photosynthesis, and oxidize water to provide electrons for energy generation. Thus, we classify cyanobacteria as _________. a. photolithotrophs b. photoautotrophs c. chemolithoautotrophs d. chemo-organotrophs
1) would you describe the contents of the soil-inoculated broth as being a “pure culture”? Why or why not? 2) How did the uninoculated broth differ in appearance from the broths inoculated with E. Coli and M. Luteus? And then how could you tell if a supposedly sterile, uninoculated broth was contaminated? Please explain in detail and highlight the important parts cuz I am confused and need help! Thanks
1. The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which converts superoxide to molecular O2 and H2O2 b.Catalase which converts hydrogen peroxide (H2O2) to water and molecular O2 c.Both A and B d.Neither A nor B 2. Prions have the following characteristics EXCEPT a.Cannot be destroyed by enzymes known to digest DNA or RNA b. Do not have nucleic acid c. Do not have protein molecules d. Tiny infectious molecules sensitive to urea, phenol, and other protein denaturing agents PLEASE ANSWER BOTH QUESTIONS, ASAP Please no need for long explanation
Pseudopeptidoglycan is a characteristic of the walls of ________. a. eukaryotic cells b. bacterial prokaryotic cells c. archaean prokaryotic cells d. bacterial and archaean prokaryotic cells
Unlike eukaryotic cells, prokaryotic cells ________. a. have no plasma membrane b. have RNA but not DNA c. have no nucleus d. a and c
The bacteria which oxidize various inorganic substancesand use the released energy for the synthesis of food arecalled _______________.(a) Archaebacteria(b) Heterotrophic bacteria(c) Photosynthetic autotrophic bacteria(d) Chemosynthetic autotrophic bacteria Please try to break the solutions into as many steps as practically possible and the steps should come one by one and they should be short and crisp and plagiarism-free.
Mitochondria likely originated froma. archaeab. invaginations of the cell membranec. rickettsiasd. cyanobacteria
The amoeba E. histolytica is a pathogen that forms liver abscesses in infected individuals. Its metabolic classification is most likely ______. a. Anaerobic heterotroph b. Mixotroph c. Aerobic phototroph d. Phagocytic autotroph
1. Which statement about Archaea is INCORRECT? a. Prokaryota is the earliest classification of Archaea. b. Archaebacteria and Archaea both exclusively refer to extremophiles. c. Monera includes Archaea and Bacteria based on morphological features. d. Archaea diverged from Eukarya implying its close evolutionary relationship. 2. Which does not justify the chemical stability of Archaeal plasma membrane? a. The ether bond across Archaea makes the phospholipid stable. b. The paracrystalline surface of Archaes contributes to the stability of the cell. c. The fused isoprenoid chains provide rigidity and resistance for the cell. d. Variability of the lipid tail provides a variety of advantages to survival of the cell. 3. Which of the following are the probable reasons for the resistance of some Archaea to extreme conditions? I. isoprene II. lipid monolayer III. paracrystalline surface protein IV. ringed chains V. protein sheath VI. glycerophosphate a. I, II, IV, V b. I through VI c. I, II,…
The peptidoglycan region in archaea is connected to each other by a: a) tetrapeptide b) Teichoic Acid c) Lipoteichoic acid d) all of the above e) none of the above