Answered: Given the following frequency, what is…

Given the following frequency, what is the sequence of the chromosome map? D-A: 6%; D-E: 12%; V-E: 2%; and D-V:8% A. EVAD B. DVAE C. DAVE D. VDEA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 14QP: Variations in Chromosome NumberAneuploidy Describe the process of nondisjunction and explain when it...

See similar textbooks

Related questions

Q: Which statement about homologous chromosomes is FALSE? Select one: a. They contain the same…

A: Homologous chromosome – During fertilization in a cell, one from the pair from the mother and…

Q: In 1-3 sentences each define the follwing terms: genetic linkage, crossing over, X-inactivation,…

A: The study of the heredity, variations is known as Genetics. The genetics that is related to the…

Q: If a centromere probe is used in FISH analysis how many spots will light up in the cells of an…

A: Given: If a centromere is used in fish analysis how many spot will light in the cells of an…

Q: Karyotype analysis shows that the banding pattern for chromosome 1 is the reverse of the normal…

A: Introduction : A Chromosome Is A Lengthy DNA Molecule That Contains Part Or All Of An Organism's…

Q: In a species of rat, the map unit distance between genes A, B, C and D were as follows: (in the…

A: There are 4 genes : A , B , C , D in the species of rat. Basically , Map unit or m.u or cM is the…

Q: Give a reason for the discontinuous synthesis of DNA on one of the parental strands?

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: How can duplications arise? A. by uneven crossing over during meiotic prophase B. by the…

A: by uneven crossing over during meiotic prophase

Q: . All the genes on one chromosome are said to form aa. chromosomal group.b. recombination group.c.…

A: All the genes on one chromosome are linked together on a continuous DNA (deoxyribonucleic acid)…

Q: A. Give 7 genes located on X chromosomes and provide 2 protein products of each gene. B. Give 4…

A: Question: A. Give 7 genes located on the X chromosome and provide 2 protein products of each gene.…

Q: Chronic myelogenous leukemia is usually associated with which type of chromosome rearrangement? a.…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: When recombination (“crossing over”) doesn’t happen correctly, what type(s) of mutations that can…

A: Crossing over is a process of exchange of chromosomal segments between the non-sister chromatids of…

Q: Due to crossing over within an inversion loop, a heterozygotewith a pericentric inversion may…

A: Inversion is a type of mutation in which a chromosome segment is broken in two places, turned upside…

Q: The set of specific alleles on a single chromosome is known as what? a. A phenotype b.…

A: Alleles are the alternative forms of a gene and it determines a particular character or a trait.

Q: When recombination (“crossing over”) doesn’t happen correctly, what type(s) of mutations that can…

A: Chromosomes are filamentous bodies present in the nucleus. They are composed of DNA(…

Q: Draw the structure of the acentromeric chromosome using a line and letters to designate loci in…

A: Inversion is one type of chromosome aberration where the chromosome segment is excised and…

Q: Determine the sterile hybrid plant and the fertile hybrid plant.

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: a. List three (3) features to identify the structure of a chromosome. b. Based on the three…

A: Introduction :- Chromosomes are the greatest level of DNA and protein organisation. Chromosomes'…

Q: Chromosome translocations include: A. Alterations in which the genetic material remains the same…

A: There are various ways by which structures of chromosomes are altered and translocation is one of…

Q: Why is random assortment of chromosomes necessary? What can we expect if this does not occur?

A: Gregor Mendel postulated a laws of inheritance ;which are mainly applicable to the eukaryotic…

Q: In the diagram in the box below the horizontal line represents a chromosome and A, B, C, D and E…

A: Recombination is the formation of new combinations of genes, this result in formation of new…

Q: In 1-3 sentences: define the term and the relationship between the terms (a) Deletion (b)…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: What term is used to describe the fact that the 5' end of one strand lines up with the 3' end of the…

A: DNA stands for deoxyribonucleic acid. It is a genetic material present in the cell.

Q: Chromosomal analysis of this karyotype reveals the mutation is a result of O A. a missing X…

A: Roughly 1 in every 2,000-2,500 live female births is affected by Turner syndrome.

Q: A chromosome with the following gene order has a paracentric inversion of BCDE. A B C D E F • G H If…

Q: а. Researchers have found that the gene that codes for APP is on which chromosome?

A: Amyloid beta precursor protein (APP) is an integral membrane protein that are usually found in the…

Q: Match Column A with Column B. v Alternative forms of a gene A Alleles B. v Physical location of the…

A: DNA is the genetic material that carries all the genetic information. The DNA is coiled around…

Q: With diagrams explain: (i) point mutations (ii) chromosome rearrangement (iii) epigenetic changes

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…

Q: By using a diagram illustrate the condition that leads to Down syndrome (2n=47,extra copy of…

A: Down syndrome is congenital autosomal genetic disorder due to the trisomy 21 number chromosome,…

Q: A change in chromosome structure that does not involve a change in the total amount of genetic…

A: A chromosomal rearrangement involves the changes in the native structure of a chromosome.

Q: a. Draw the structure of the acentromeric chromosome using a line and letters to designate loci in…

A: A homologous sets of chromosomes comprises of one chromosome from each parent. During the majority…

Q: Does the mechanism of recombination of unlinked genes require crossing-over? Explain your answer.

A: No, the mechanism of recombination of unlinked genes does not require crossing-over.

Q: Explain how mitotic recombination leads to the mosaiccondition termed twin spots.

A: Mitotic recombination is a kind of genetic recombination takes places in somatic cells at a time of…

Q: A paracentric inversiona. includes the centromere within the inverted region.b. does not include the…

A: Inversion is a type of mutation in which the chromosome rearrangement takes place, in which a…

Q: а. Researchers have found that the gene that codes for APP is on which chromosome? b. Does everyone…

A: Answer: APP GENE = This gene provides instructions for making protein called amyloid precursor…

Q: Explain what linkage is, why linked genes do not assort independently, and state what must happen…

A: Gene is defined as the sequence of nucleotides that encode a protein. The linkage term was given by…

Q: Can you cite a situation in which it shows how important two strands on the same chromosome have…

A: In eukaryotic cell,during cell division one of its main jobs is to make sure that to show and bind…

Q: A mechanism that may cause a translocation isa. the joining of reactive ends when two different…

A: Chromosomes may undergo rearrangements that are the mutations in the chromosomes that can alter the…

Q: The process of mitotic recombination involves the a. exchange of chromosomal regions between…

A: The organisms have different techniques to increase their genetic diversity. Techniques such as…

Q: Which recombination frequency corresponds to independent assortment and the absence of linkage? a. 0…

A: Meiosis is a type of cell division wherein the daughter cells formed are half the ploidy level as…

Q: If a crossover began in the short region between gene A and the tip of the chromosome, would this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Explain what it is a region of condensed pinched chromosomes?

A: Chromosomes are stainable condensed chromatin fibres that are rod-shaped or threadlike. They are…

Q: "A deletion of a portion of a chromosome need not be very great before the effects become severe".…

A: The genetic material of a cell is a nucleic acid. Most of the organism has DNA as the genetic…

Q: Production of more than one phenotypictrait by a single gene is calleda. pleiotropy.b. genetic…

A: Pleiotropism or pleiotropy is the phenomenon of multiple effect of a gene in which a sing e pair o…

Q: Which changes in chromosome structure cause a change in thetotal amount of genetic material, and…

A: Chromosomal aberrations are changes in the number and arrangement of genes in the chromosomes. They…

Q: Pea plants have seven different types of chromosomes. A chromosome with a centromere at the very end…

A: Chromosomes are divided into two parts (p and q arms) with a constriction point called a centromere…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

Given the following frequency, what is the sequence of the chromosome map? D-A: 6%; D-E: 12%; V-E: 2%; and D-V:8%

A. EVAD

B. DVAE

C. DAVE

D. VDEA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following frequency, what is the sequence of the chromosome map? A-G: 18%; R-G: 3%; A-K: 3%; and A-R:7% A. AKRG B. ARGK C. GRKA D. RKGA
Construct a map of the chromosome, with the most accurate map distances, from the following recombination frequencies between individual pairs of genes: C –F 13%, V –F 20%, V –C 8%, S –F 4%, C –S 9%,
Chromosome translocations include: A. Alterations in which the genetic material remains the same but rearranged B. Alterations in which the total amount of genetics information increases C. Alterations in which the total amount of genetics information decreases D. Variations in the chromosome number
Construct a map of the chromosome from the following recombination frequencies between individual pairs of genes: c – f 8%, v – f 12%, s – v 16%, v – c 4%, s – f 6%
Show the exact location of the following gene in the chromosome. Draw and label. 2p32.1 2q42.2 2p21.3 2q12.3 2p11.2
What is a molecular marker? Elaborate physical chromosome mapping with the help of molecular markers
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
What structures are found in a chromosome? Group of answer choices Two structures for the mitotic spindle to bind, and two complex repetitive structures that are maintained by telomerase One structure for the mitotic spindle to bind, and two complex repetitive structures that are maintained by telomerase One structure for the mitotic spindle to bind, and one complex repetitive structure that is maintained by telomerase Two structures for the mitotic spindle to bind, and one complex repetitive structure that is maintained by telomerase.
Determine the correct order of the genes on the chromosome, given the following information:Genes A and D cross over at a rate of 22%Genes A and L cross over at a rate of 5% Genes L and D cross over at a rate of 27% Group of answer choices LAD ADL DLA LDA
With the given frequency, construct a chromosome map. Arrange the sequence correctly. Write the letters as shown in the example (ex. ABCD). Frequency: M-A: 10%; M-Y: 2%, L-A: 2%; and Y-L: 6%
A geneticist determines that the order of four genes on a specific chromosome is CABD because the recombination frequencies were 35% for C-D, 24% for A-D, 23% for B-D, and 10% for A-B. What has the geneticist constructed?
Variations in Chromosome NumberAneuploidy Describe the process of nondisjunction and explain when it takes place during cell division.