Q: Describe and explain the necessary changes that health systems worldwide must undergo to improve ada...
A: Introduction :- Healthcare system is a system consisting of institutions ( like hospitals, dispensar...
Q: In squash vegetable: What are the enzymes, pigments, flavors present in squash?
A: Squash is a plant that comes in a variety of shapes and sizes. Squash is one of the most adaptable f...
Q: The offspring of the cross AA × aa are______ . a. all AA c. all Aa b. all aa d. half are AA and half...
A: The term Punnett square is associated with the table that plays an important role in describing the ...
Q: Please explain how different detergents take out proteins selectively out of membrane. (Choose one p...
A: Integral membrane proteins are completely embedded inside the membrane whereas peripheral membrane p...
Q: intermediate filaments 1. In eukaryotic flagella, the fibers that slide past one another due to the ...
A: Intermediate filaments: They anchors the nucleus and maintains its rigidity Microtubules: They aids ...
Q: Define the following terms: Bactericidal Bacteriostatic Antisepsis
A: Microorganisms are microscopic and most of them causes harmful effects in human body, but some of th...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: What is thermal death time? What are the factors that may influence the efficiency of chemical growt...
A: Answer 1 :- Thermal death time is the way lengthy it takes to kill a particular bacterium at a parti...
Q: A marathon runner was disoriented and delirious post-race, and was found to have a serum [Na ] 128 m...
A: The correct option is C.
Q: Photosynthesis is defined as the chemical process, wherein carbon dioxide in the presence of water a...
A: The plants have three basis needs to grow better. These are, 1) Sunlight 2) Water 3) CO2 Along with ...
Q: Identify this connective tissue. loose connective tissue compact bone O blood O adipose tissue O car...
A: Connective tissue: these tissues play supporting role in joining the other tissues or organs. E. g. ...
Q: Phenylethyl alcohol and why would it be useful in agar
A: Acoording to this question we have to decribe phenyl alcohol and the phenylethyl alcohol be useful i...
Q: what components makes a test effective?
A: Testing effectiveness It refers to the effectiveness of how testing is performed or how the goal is ...
Q: Which reaction normally happens in the regulation of the trp operon when high levels of tryptophan a...
A: The trp repressor controls the trp operon. When coupled to tryptophan, the trp repressor prevents th...
Q: True or False: The output of the Mass Spectrometer gives us the exact mass of a molecule.
A: The output of the mass spectrometer is the separation of molecules based on their m/z (mass to charg...
Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...
A: The correct option is C.
Q: Illustrate a hypothetical food web of the seagrass ecosystem services by using words and arrows
A: * food web is interconnection of food chains and a graphical representation of eating behaviour in ...
Q: Give the importance of the following factors in bacterial characterization methods: (a) cultures, (b...
A: A microbe is a living entity that is so tiny that it cannot be seen with the naked eye. Microbiology...
Q: Anatomy and Physiology Answer the following (A) 1 and 3 are correct (B) 2 and 4 are correct (C) 1, 2...
A: Catecholamines are hormones secreted by the adrenal glands of the kidney and it includes epinephrine...
Q: 2- Supposed that you have a DNA sequence sample with 10,000 bp. By using 2 different restriction enz...
A: The answer is 3.
Q: If agriculture on once-virgin tropical forest area were to stop, how would you speed-up the process ...
A: Secondary succession It refers to the ecological succession that takes place after the disruption of...
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: Diffusion is a random motion of molecules and movement of water from high to low concentration.
Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...
A: Egg white It refers to the clear liquid present inside the egg. It is formed from the layers of secr...
Q: What are the advantages and disadvantages of an endoskeleton?
A: The endoskeleton is the internal skeleton or cartilagenous structure of organisms (vertebrates) that...
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: Lipids solubility of a water insoluble substance play most important role in governing its diffusibi...
Q: Herpes Simplex Virus 1
A: Herpes simplex virus is a common virus that causes infections of the skin and mucous membranes. It c...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A: Different types of bacteria form different types of bacterial colonies which differ in their morphol...
Q: Question 6 When light hits the special light-reactive molecular units inside rod cells, how do these...
A: Answer 6- One bond shifts positions from cis to trans orientation Answer7- cephalopods evolved eyes ...
Q: Dinosaurs like hardosaurs and others like duck bills if be hunter by predators what is their defense...
A: When a species goes extinct, it loses all of its genetic legacies. In order to adapt to environmenta...
Q: Andalusian chickens may be either black, white, or gray. The gene for black is not dominant over th...
A: Note- we are supposed to answer 1 question with three subparts according to our guidelines. Please r...
Q: similarities and differences between malaria and covid 19
A: An infection is the invasion of an organism's body tissues by disease-causing agents, their multipli...
Q: Types of homo sapiens
A: Homo is a genus that arose from the (now extinct) genus Australopithecines and includes the extant s...
Q: Extract from Soursop Leaves Can Prevent the Symptoms of Fibromyalgia"? a) The article doesn't discus...
A: The given article summarises the use of Annona muricata L. leaves for preventing fibromyalgia. It gi...
Q: QUESTION 1 Ion pumps.. DA Use the energy of ATP hydrolysis to move ions against their concentration ...
A: Ion pumps use energy from ATP hydrolysis to transport ion against the concentration gradient. They c...
Q: Indicate your answer by writing Y if a characteristic and N if a non-characteristic. If the characte...
A: Eukaryotic organisms have well-developed nuclei surrounded by nuclear membrane while prokaryotes do ...
Q: 6-11. Match the segment of the nephron in the first column with the correct epithelial lining. Refer...
A: Nephron is the functional unit of the kidney which helps in the process of removing waste in the uri...
Q: Match each term with the best description. ___ DNA replication a. basis of variation ...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: What is pharmacogenomics, and the role it plays on fast and slow etabolism and how it affects the to...
A: Pharmacogenomics is an approach to the advanced medical science which states or aims to define a pro...
Q: What would happen to the fox population if most of the mice died from disease? the foxes would eithe...
A: Animal interaction Interaction of different kinds of animals depends upon theirs nature. There are ...
Q: Which part of this inner ear labyrinth has otoliths that roll over gel-topped sensory cells to send ...
A: The ear is divided into three parts viz., inner ear , middle ear and outer ear. The inner ear is als...
Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans: TTACACTTGCTTGAGAGT...
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for you...
Q: 1) What makes the heart sounds? 2) Know the whole cycle/route that the blood takes from the heart th...
A: 1.Blood does not pass back from the atria into the great veins because the roots of great veins are ...
Q: You counted 40 colonies on a plate in your dilution series. The plate was inoculated with 1.0ml from...
A: A microbial sample will have enormous amount of cells. To estimate this by calculation, the sample i...
Q: explain why there is little to no growth of these organisms in the minimal salt media with glucose c...
A: Bacteria are inhibited by salt in a variety of ways. It's a disruptor that causes mayhem in microorg...
Q: You are Jeremy’s Biology professor, and he ask you about taking steps to “bulk up”. What would your ...
A: Being a doctor and taking this question as in general category. One should do the followings things ...
Q: Identify the statement below that is the MOST TRUE O All personality traits are equally heritable.
A: Personality traits are those which we acquire during our lifetime.
Q: MDCK cells Jurkat cells 45 sphingolipida/GPL 45 sphngolpds/GPL cholesterolGPL 4. 4. 3.5 cholesteroGP...
A: DRM or detergent resistant membrane is mostly prepared by applying any detergent (such as: Triton X)...
Q: back ground study of ampalaya
A: Introduction: Ampalaya is also known as Momordica charantia found in the tropical regions of the wor...
Q: if a parent cell with a diploid number of 12 or two divide by meiosis each daughter cell would have ...
A: Introduction: The production of offspring by sexual reproduction includes the fusion of two gametes,...
Q: A can cleave the hinge of each heavy chain as shown below.
A: IgG is cleaved with a protease that is the one which targets the hinge region. Proteolytic cleavage...
Step by step
Solved in 3 steps
- Give examples of othe histological stains that. Would be useful for acute HBV infrA 3-year-old severely ill child was admitted to a hospital withsymptoms of diarrhea, fever, and malaise. Laboratory testing showedabnormal renal and liver values and anemia. She had no history ofprevious illness, and her food history was a recent meal of teriyakibeef consumed at a local restaurant.a. What was the probable pathogen?b. What was the likely source?c. What is the pathologic effect of the pathogen?1. Name at least five hematologic malignancies that are commonly diagnosed with the aid of flow cytometry. Provide the hematologic pattern seen in flow cytometry output of these malignancies/conditions. 2. Provide two advantages and two disadvantage of flow cytometry analysis. Briefly explain each.
- I. In routine stool examination, what is a Floatation Technique? Guide:a.) What the procedure is used forb.) Summarized Procedurec.) Organisms in stool that are not viable after using Floatation Techniqued.) How common is the test being done in our country (Philippines)? (NOT YET SOLVED)1. 8-10 sentences state the reason why stool examination important in the s Clinical Parasitology? Please answer it in your own words. Do not plagiarize.Discuss the following: Listeria monocytogenes (Listeriosis) Microscopy Identification tests used (at least 1)
- Give the lab Diagonis For clostridium difficilein 200 words discussed the prevalence of fasciala hepatica in guyana and also provide refernece alsoAn outbreak of Methicillin-resistant Staphylococcus aureus (MRSA) in the surgical ward at the hospital forces the hospital administrator to cancel and postpone all non-essential surgeries until the source of infection has been located and for measure put into place. Bacterial samples obtained from swab of wad staff equipment and surfaces arr brought to the lab for analysis. 1. What testing method will you employ to determine the level of exposure? 2 How would a positive test present? 3. How would a negative test present? 4. What recommendations would you make in your report?
- How does Candida albicans identified in person with Candidiasis? Discuss specific tests being done and how it is executed. As possible, explain in comprehensively.Based on the picture. What are the clinical manifestation (column b) and classification based on gram staining and morphology (column c) of: Meningococcemia and Second most common cause of UTI in sexually active womenBest method to demonstrate ova of E.vermicularis: a. acid-ether concentration b. cellophane tape preparation c. formalin-ether concentration d. zinc sulphate floatation e. paraffin melting method 6. Toxoplasma gondii is transmitted to human by except: a. ingestion of soil contaminated by oocyst from cats b. ingestion of cysts in undercooked meat c. congenital transmission from mother with acute toxoplasmosis d. organ transplant and blood transfusion (infected donor) e. NOTA