Give the importance of the following factors in bacterial characterization methods: (a) cultures, (b) morphology, (c) physiology, (d) biochemistry,
Q: Which of these is likely to reduce enzyme activity I. Increasing pH level II. Decreasing temperature...
A: "Enzymes" are essential components of all metabolic processes in the body. They are catalytic protei...
Q: The membrane potential in animal cells, but not in plants, depends largely on resting K+ channels. H...
A: Ion channels are the membrane proteins that mediate the movement of ions across the membrane.
Q: If a person reaches a BAC of 0.060% and then stops drinking, we would estimate that all alcohol woul...
A: Introduction :- Blood alcohol levels are decided by the blood alcohol concentration calculator . It ...
Q: Hardosaurs like edmontosaur or others what ways they can defended against predators like tyrannosaur...
A: Dinosaurs have helped scientists comprehend the Earth and its history by allowing them to examine di...
Q: Which of these is a tetrapod that is NOT an amniote?
A: Tetrapoda is a Greek term that means "four legs. The Tetrapoda includes amphibians, reptiles (includ...
Q: Explain the cell division limit and its fail-safe function
A: Introduction Almost all cells in the body can divide and form new daughter cells however, there are...
Q: All genes regulated by PKA contain a cis-acting DNA sequence that binds to the phosphorylated form o...
A: PKA-promoted protein phosphorylation has both transcriptional and posttranscriptional results. The f...
Q: Discuss the 4 lobes of the brain its function and relation to our behavior
A: Our brain is divided into 4 different areas that execute particular functions, these are known as lo...
Q: What is the relationship of evolution and human behavior?
A: The evolution and human behaviour are related to each other. Evolution occur due to natural selectio...
Q: Which of the following statements about the world population is NOT true?
A: Analysts estimate that the global carrying capacity of the earth is about 50 billion. The world popu...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: Identify the statement below that is the MOST TRUE O All personality traits are equally heritable.
A: Personality traits are those which we acquire during our lifetime.
Q: If you are provided with a CHO cell line expressing an adrenergic receptor, how could you experiment...
A: Introduction :- Chinese hamster ovary (CHO) cells are epithelial cell lines derived from the ovaries...
Q: Remember that although there are many interesting ideas about genetic engineering of plants and anim...
A: Genetic engineering is a one of the modern technology to modify organisms, plants, crops & even ...
Q: peroxisome nuclear pore chloroplast nucleus smooth ER nucleolus microfilament ribosome Golgi apparat...
A: INTRODUCTION Cell is a basic functional unit of life system. Cell is mainly a collectio...
Q: The large muscle group that attaches the leg to thepelvic girdle and produces extension of the hip j...
A: Introduction: Muscular tissue is a specialised animal tissue that applies force through contraction ...
Q: An unknown microbe is found to be able to photosynthesize, but is also able to fix pyruvate for carb...
A: An autotroph is an organism that can produce its own food using light, water, CO2 and other chemical...
Q: What is the maximum number of different alleles for a particular locus that can be present in a sing...
A: ANSWER: ALLELE- An allele is a variant form of a gene. and a gene is a sequence of nucleotides that...
Q: Hardosaurs like edmontosaur the front feet do they have name or description how they look? It looks ...
A: The comb-crested hadrosaurid (duck-billed) dinosaur Edmontosaurus regalis is a species of comb-crest...
Q: Simple but creative caption on a poster about noncommunicable diseases caused by having unhealthy li...
A: A non-communicable disease (NCD) is a disease that is not transmitted from one person to another. N...
Q: Identify the method of sterilization/ chemical agent described This chemical agent is used as a sta...
A: Various methods of sterilization have been used in laboratories and pharmaceutical industry.
Q: A solute cannot move into a cell by crossing the phospholipid bilayer of the membrane. It can, howev...
A: Plasma membrane is a bilayer structure composed of phospholipids that has different proteins embedde...
Q: 1. What is the significance of the formation of the blastocoel and blastoderm during blastulation? 2...
A: Blastulation It refers to the production of blastula during the early stages of animal embryonic dev...
Q: What is transpiration
A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...
Q: If the a and b loci are 40 cM apart and an AABB and aabb individual mate: What gametes will the F1 i...
A: The recombinants means the individual form by combination of two different alleles other than parent...
Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...
A: The correct option is C.
Q: What is the nature of the targeting sequence, and what distinguishes it from other types of targetin...
A: Introduction In the cell, there is a highly regularized transport mechanism that works for the tran...
Q: Rates for sexual behavior are typically based on population surveys. What factors might affect the a...
A: Various factors are responsible for variation in sexual behaviour like race, age, gender etc. Cross ...
Q: explain how eugenics can be considered a pseudoscience by using at least two characteristics of pseu...
A: Solution : Eugenics is the scientifically erroneous and immoral theory of “racial improvement” and “...
Q: How does the translated mRNA convert into a functional protein?
A: Translation is a process in which cells make the proteins.
Q: The enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends: BamH I: ...
A: Restriction enzymes or endonucleases are enzymes that recognise particular DNA sequences at the rest...
Q: Did Soap Operas Reduce Fertility in Brazil?
A: In Brazil, there were no strict rules for a population control policy by the government, and it is i...
Q: Describe the way a Punnett square is used
A: Introduction :- The Punnett square is a square diagram used to forecast genotypes in a cross or bree...
Q: Helping tags; biology, food, scientists What topic may have been developed to address food safety i...
A: According to me the best pair of scientists amongst the given options is that of Anton Van Leeuwenho...
Q: Individuals of genotype AaBb were mated to individuals of genotype aabb. One thousand offspring were...
A: Individuals of genotype AaBb were mated to individuals of genotype aabb. One thousand offspring were...
Q: PROBLEMS 8.1 An enzyme-catalysed reaction was found to be affected by two inhibitors A and B. The fo...
A: Introduction: Enzymes are macromolecular biological catalysts. Enzymes accelerate chemical reactions...
Q: 3. Explain the movement of indirect protein transport; where are the proteins made, WHere Jie they g...
A: Mechanical protein digestion begins in the mouth and progresses to the stomach and small intestine. ...
Q: Give the characteristics of cancer cells and distinguish them from normal cells
A: Introduction: Cancer is a disease occurring due to cellular changes that result in the uncontrolled ...
Q: Dinosaurs like hardosaurs and others like duck bills if be hunter by predators what is their defense...
A: When a species goes extinct, it loses all of its genetic legacies. In order to adapt to environmenta...
Q: List and explain at least 3 Viral infections of the skin.
A: Skin is the outermost protective layer of our body. It can be caused by different microorganisms, ...
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...
Q: Define the following terms: Bactericidal Bacteriostatic Antisepsis
A: Microorganisms are microscopic and most of them causes harmful effects in human body, but some of th...
Q: How many N-terminus are there in this cartoon?
A: *There are four types of protein structure are present. primary structure secondary structure terti...
Q: Name and describe the idea that explains how mitochondria and chloroplasts are thought to have origi...
A: Photosynthesis is the process through which green plants and some organisms use sunshine to convert ...
Q: in your own words, describe how genetic diversity makes a population resilient to environmental chan...
A: Genetic diversity is defined as the potential to resist a number of epidemics as well as diseases. G...
Q: [Question 27] Helping kin raise offspring is one way individuals can increase their inclusive fitnes...
A: Introduction: Pedigree analysis is the study of a particular trait that is inherited from one genera...
Q: Certain proton pump inhibitors that inhibit secretion of stomach acid are among the most widely sold...
A: H2 blockers or histamine H2-receptor antagonists are drugs that minimize the acid production in the ...
Q: Phenotype to Population: 1. Describe how the phenotype of individuals with sickle cell disease influ...
A: Sickle cell anemia is an autosome linked (recessive) genetic disorder.
Q: If the pressure in the ventricles is higher than the pressure in the atria, but lower than the press...
A: Heart valves open and close in response to pressure changes inside the heart chambers. the fluid und...
Q: What is a selective sweep? O When a beneficial mutation is lost due to genetic drift. O When a benef...
A: Certain terms are fundamental concepts in biology, the study of living organisms. Theses terms are s...
Give the importance of the following factors in bacterial characterization methods: (a) cultures, (b) morphology, (c) physiology, (d) biochemistry, (e) nutrition, (f) chemotaxonomy, and (g) serology.
Step by step
Solved in 2 steps
- What is the advantage of using Molecular data compared to plated culture or biochemical techniques in identifying bacterial species, especially for oral microbes ?Why is it important to follow sterile technique? What can happen to cause gram-positive bacteria to appear gram-negative?what practical significance are capsule forming bacteria in industry and medicine?
- What is the advantage of culture-independent analysis over culture-dependent analysis of microorganisms?How would you expect the staining properties of 24-hour culture of Bacillus subtilis or the other Gram-positive bacteria to compare to culture that is 3 to 4 days older?Are the large numbers of microorganisms found in the mouth cause for concern? Explain. How can you determine whether a culture or subculture is pure? What kinds of clinical speciments may yield a mixed flora in bacterial cultures? Why was a blood agar, rather than a nutrient agar, plate used for the culture from your mouth?
- What do you mean by Immunoelectron Microscopy?What are the disadvantages of using the mouth in filling a pipette? Why do we use exponential notation in counting bacteria? Why is serial dilution necessary?Write the steps involved in making bacterial smear? And what the purpose of doing it beforeany staining procedure? Write the steps involved in simple staining ? And what the purpose of doing it ?