Hos is the contractile vacuole different in appearance from the Amoeba

Q: Multiple Choice Question In an insect sensillum:    a. the Semper cell forms the socket.    b. the…

A: Introduction:- The sensillum of an  arthropod has a  sensory organ that protruding from the cuticle…

Q: For this exercise, consider one of the three diseases discussed in the section "The Triangle of…

A: Triangle of human ecology is discovered by- Meade and Earickson. Which explains an individual's…

Q: Trilobitomorpha Arachnida Decapoda Hexapoda # of Body Segments 2 3 3 # Pairs of Legs several 4 5 3…

A: Arthropods The invertebrate animals that includes insect, crustaceans, spiders etc.

Q: neurobiology How does asymmetric cell division and localization of sequential acting transcription…

A: Development biology studies how cells develop into organs and how time and geography impact cell…

Q: Name ten examples of bacteria and give their colony morphology. ( indicate the media used for each)

A: Scientists utilize a technique called colony morphology to define the properties of a specific…

Q: The following describes the relationship between fluid in a red blood cell and 0.9% NaCl: O a…

A: Introduction  Osmotic gradients between intracellular and extracellular fluids are generated, and…

Q: Identify each cell below as prokaryotic, plant cell, or animal cell, then identify the labeled…

A: The fundamental building block of life is the cells. All living things are constructed from many…

Q: Give 4 exercise with the he of anatomical terms in describing the position and positive effect of…

A: Physical exercise is a subpart of physical activity that is intended, structured, and redundant,…

Q: Thalassemia, a disease in man which results in anemia, is controlled by a dominant gene N.…

A:

Q: Compare the mechanisms of LINE and SINE transposition

A: Non LTR retrotransposons dont contain long terminal repeats but they contain genes for reverse…

Q: The following is a type of endocytosis involving the cell drinking fluids: O a. Na-K-ATPase Protein…

A: Introduction :  The process of endocytosis is when the materials enter the cell. The process…

Q: Discuss the absorption of amino acids in the small intestine.

A: Introduction The digestive system's function is to convert the macromolecules present in the food…

Q: Within a school of fish, each distance from its neighbors as they swim. When viewed from farther…

A: School of fish In biology, when a group of fish stays together and is swimming in a similar…

Q: Match description with Term:   1) determine the amount of protein in a sample 2) determine the…

A: Recombinant DNA technology is a method by which several different genes can be combined from two…

Q: Mendel proposed the Principle of Independent Assortment based on results from which type of…

A: 1.) The correct option is: dihybrid cross, The Law of Independent Assortment, as Demonstrated by…

Q: Scenario #3: Arsenic poisoning. Ralph worked in a zinc refinery for 30 years. He never missed a…

A: Cellular respiration is the process by which glucose is broken down and produce energy in the form…

Q: Water travels from a region of hypotonic fluid to a region of hypertonic fluid across a selectively…

A: A solution with a lower solute concentration as compared to a solvent is called a hypotonic…

Q: why would a cell invest ATP to move particles using active transport?

A: Materials must be moved against a concentration or electrochemical gradient, which requires the cell…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: The cell membrane facing the extracellular fluid is lined by the following: O a No Charges Ob…

A: Plasma membrane or cell membrane is a semi-permeable membrane which surrounds a cell. It is a double…

Q: What enviroment factors would have contributed to there being bacteria on a door handle inside a…

A: Everyday door handles are one of the hotspots for bacteria, especially public handles. Because of…

Q: What particular pathways or enzymes appear distinct for sulfate reducing bacteria in order to…

A: INTRODUCTION : Sulfate reducing bacteria - It is a type of bacteria which can reduce sulfate.They…

Q: In the process of osmosis, the molecules of the solute travel from the solution with higher…

A: We know that osmosis is a process by which the solvents of a solution move from the lower…

Q: How can a B cell have both IgM and IgD on its surface?

A: * B cells produce from lymphoid progenitor cell which develop in fetal liver and later in bone…

Q: The is the organelle that is formed when an endosome, containing hydrolytic enzymes necessary for…

A: Cell is the basic structural and functional units of organism. The cell is made up of various kinds…

Q: For the below mating, what proportion of offspring will be blood type A? H/h; A/i* H/h; A/i A) 1/4…

A: Introduction  The classification of blood based on the presence or absence of antibodies and…

Q: In Figure 13-19C, the regulation of cholesterol synthesis by LDL in normal cells is compared with…

A:

Q: If you have chosen the objective lens with 10x and the ocular lens magnification is also 10x. Then…

A: Introduction  Magnification is the process of enlarging something's perceived size—not its actual…

Q: Why temperature decreases in mesosphere but with full explain.

A: Introduction :- The third layer of the atmosphere, the mesosphere, is situated just above the…

Q: The graph below shows the species richness of a community undergoing secondary succession. The…

A: Secondary succession is a succession which occurs in a place where an already developed community…

Q: The following describes the decrease concentration of particles in water: O a Hypertonic Fluid Ob.…

A: Introduction :  Osmosis is defined as the movement of solvent molecules through a selectively…

Q: If you have chosen the objective lens with 10x and the ocular lens magnification is also 10x. Then…

A: INTRODUCTION : Objective lens of a compound microscope : A microscope is an instrument which is used…

Q: Describe the pharmaceutical uses of at least four (4) different types of alkaloidal drugs, including…

A: Introduction; A group of naturally occurring organic nitrogen-containing substances known as…

Q: Visit www.mayoclinic.org to learn more about the gallbladder's role in fat breakdown. What dietary…

A: The dietary suggestions following gallbladder removal. 1. For at least a week following surgery,…

Q: What are the objectives of these in vitro fertilization treatments? Please give examples

A: In vitro  fertilization means that if some one couple have any problem not getting the pregnant…

Q: WHAT is the subject of the figure above? WHAT is the main message of the figure? Give a BRIEF but…

A: Biotechnology is the use of our comprehension of biological processes to develop practical clinical…

Q: Pictured is one of the life stages of an Aurelia sp., or Moon Jellyfish, a Scyphozoan. Which life…

A: Introduction cnidarian, also called coelenterate, is a phylum under the kingdom Animalia containing…

Q: Continue to assume that the same four individuals in the pedigree are albinos, and calculate the…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: If a B cell receptor does not pass selection, is it better to be self-reactive against a…

A: In the primary lymphoid organs, such as lymph nodes and spleen, the selection is positive and…

Q: Which one of these communities is undergoing primary succession? A meadow after an intense fire…

A: Succession can be described as a natural process,in which change in the community structure takes…

Q: Greg competed in three consecutive races; at the end of the third race Greg was out of breath and…

A: Given that Greg competed three consecutive races but at the end of the third race Greg was out of…

Q: NAD+ sources sources for your cells are: FAD+, FMN, glycolysis glycolysis, the Krebs cycle, the…

A: NAD+  Necotinamide adenine dinucleotide is a co-enzyme that take part in many metabolic reactions of…

Q: Kate and her husband are both heterozygous for galactosemia gene. If Kate and her husband have four…

A: A group of hereditary disease known as galctosemia which means galactose in blood. Undigested…

Q: What is the name of the first cervical vertebra? Why is it called that? What is the name of the…

A: The long pillar like structure composed of bones called vertebrae, present as the longitudinal axis…

Q: when it rains why do we see more worms out? Use the scientific method steps to describe why we see…

A: Earthworms are a sign of good soil. These are necessary for the breakdown of organic debris (such as…

Q: In genetic engineering, can we insert the gene from human to  E. coli (bacteria)? Explain your…

A: Genetic engineering involves modification of DNA in an organism that alter The characteristics of…

Q: The essay should consider the following: A description of the key features of stem cells when…

A: Tissue engineering It refers to the branch of biomedical engineering that replaces, maintains, or…

Q: what rate in drops per minute should the flow rate be adjusted in order to administer the infusion…

A: Given 15 ml of 10% calcium gluconate and  10 ml of a multivitamin infusion are mixed with 500 ml of…

Q: What are the advnatages of slide culture technique over wet mount technique for studying molds?…

A: Wet mount technique : this is the traditional method of preparing a slide to visualise a…

Q: what does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR,…

A: Introduction A ribosome reads messenger ribonucleic acid (mRNA), a single-stranded RNA molecule that…

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.