Answered: How does polio (poliovirus) get more…

Name: How does polio (poliovirus) get more than one protein from a single mR
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: How does polio (poliovirus) get more than one protein from a single mRNA?Give typing answer with explanation and conclusion

Science

Biology

How does polio (poliovirus) get more than one protein from a single mRNA? Give typing answer with explanation and conclusion

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 3QP: If the genetic code used 4 bases at a time, how many amino acids could be encoded?

See similar textbooks

Related questions

Q: A given enzyme can work in a wide range of temperature and pH, and on a wide range of substrates.

A: Enzymes are biological catalysts that speed up chemical reactions in living organisms and they are…

Q: The mitochondrial Pyruvate Dehydrogenase Complex (PDC) is a very large enzyme complex which…

A: The three enzymes that make up the pyruvate dehydrogenase complex (PDC) are responsible for the…

Q: How is eating the right fats are good for your health

A: A macronutrient called fat is crucial for the body's correct operation. It gives off energy, aids in…

Q: How does an artificial neural network function? What is it?

A: Neurons are specialized cells that transmit information throughout the body. They are the basic…

Q: Which of the following organisms would be the most likely to have identical copies of the Alu…

A: The Alu sequence is a short DNA sequence that is found in primates, including humans, as well as…

Q: The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally…

A: RNA, stands for ribonucleic acid. It is a type of nucleic acid that is essential for the…

Q: Which step in elongation is catalyzed by RNA polymerase?

A: RNA polymerase is an enzyme responsible for catalyzing the process of transcription, which is the…

Q: In adult mammals, where does blood go directly after it leaves the right ventricle?

A: Blood is a specialized bodily fluid that circulates through the arteries, veins and capillaries…

Q: give my child the shot, make sure to sanitize their skin!" Should you sanitize their child's skin?…

A: Intramuscular injection is one of the most preferred ways to administer vaccines. It involves the…

Q: b) Place a 'Yes' or a 'No' in the appropriate boxes that correspond to each listed feature of…

A: Cellular respiration is the metabolic process by which cells obtain energy from the breakdown of…

Q: Consider the first category of test-cross offspring shown in figure 8.2 (+b, LS). Consider also that…

A: In the test-cross in question, heterozygous female flies with the genotype +b, LS were used. In…

Q: a) 5 nuclear RNA polymerases b) 3 nuclear RNA polymerases . c) 6 nuclear RNA polymerases…

A: RNA polymerase (RNAP), also known as DNA-directed RNA polymerase, is an enzyme responsible for…

Q: . In incomplete dominance, the phenotype of ____ : only one allele is expresses both alleles is…

A: "Since you have posted multiple questions, we will provide the solution only to the first question…

Q: However, if the salinity level is too extreme or the exposure is prolonged, it could lead to…

A: It has been confirmed that marine mussels can well tolerate up to 20% salinity levels. Exposure to…

Q: Describe the genetic and environmental conditions that may lead to the onset of Type 1 Diabetes…

A: INTRODUCTION Type 1 diabetes mellitus is a chronic autoimmune disease in which the immune system…

Q: In a population of 12,500 jewel beetles that is in H-W equilibrium, 1280 beetles show the recessive…

A: The Hardy-Weinberg law, also known as the Hardy-Weinberg equilibrium is a principle in population…

Q: What are the results of looking at the pure cultures of S.aureus on Baird Parker agar Cl.…

A: Differential media are forms of culture media that are intended to separate various microorganism…

Q: If a protein is predominantly made up of aliphatic and aromatic amino acids, which of the following…

A: A class of amino acids known as aliphatic amino acids has side chains with an aliphatic…

Q: Which of the following molecules would be products of amylase digestion of glycogen? cellulose…

A: Amylase is an enzyme that breaks down carbohydrates into smaller molecules such as starch and…

Q: In Africa we find albinism in around 1 in every 5,000 individuals. This is puzzling, because…

A: Albinism is a genetic disorder that affects melanin production, resulting in decreased pigmentation…

Q: A person has a tumor of the adrenal cortex that hypersecretes aldosterone and is not regulated by…

A: Primary hyperaldosteronism, also referred to as Conn's syndrome, is a disease in which the adrenal…

Q: Match the biochemical test mediums to the chemical components for test reaction: OTSI TSI and SIM…

A: Biochemical test media are specialised growth mediums created to promote the growth and metabolic…

Q: Give typing answer with explanation and conclusion The content of nucleolus is __ with the rest of…

A: Nucleus is the control centre of the cell and contains the genetic material and nucleolus. Nucleus…

Q: After comparing the whole genome sequencing results from a candidate that you suspect has a mutation…

A: A missense mutation is a type of genetic mutation that causes a change in a single nucleotide of the…

Q: Which of the following statements about metabolic heat is true? A. Relative to their body size,…

A: The heat produced as a byproduct of metabolic processes occurring within living organisms is known…

Q: Which of the following is true of the circulatory system of a grasshopper? A. One or more muscular…

A: To obtain oxygen into the blood, the circulatory system (cardiovascular system) blood is pumped from…

Q: B. TRUE OR FALSE. _____. Endocytosis is the movement of quantities of molecules out of a…

A: Note: “Since you have posted multiple sub-parts of a question, we will provide the solution only to…

Q: According to the Fick equation, the fish gill is an effective gas exchange surface because... A. It…

A: The Fick equation is a mathematical formula that describes the rate of diffusion of a gas across a…

Q: When an antigen enters the bloodstream, it triggers ____________________ Question 7 options:…

A: Antigens are molecules that the body recognises as non-self or foreign. They can be found on the…

Q: Any memorization device that helps a person recall information a) Mind mapping b) Mnemonic c)…

A: Information that is recalled means that information is retrieved through a memory bank placed in our…

Q: 1. Name the two types of structures that mediate cell-cell contact and are associated with…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: The duplicated chromosomes are separated during: O Nucleosis O Cytokinesis II O Mitosis O…

A: The cell cycle is a series of events that a eukaryotic cell undergoes as it grows, replicates its…

Q: 10. Passive transport: a. occurs from regions of low to high concentration. b.…

A: Transport refers to the movement of substances such as molecules or ions, into, out of or within…

Q: Give typing answer with explanation and conclusion The father of Mr Spock, first officer of the…

A: A hereditary issue includes the inheritance of characteristics between two distinctive species…

Q: MATCH THE FF. WITH THE CHOICES BELOW recombination involving similar DNA sequences general…

A: Recombination is a process in which broken DNA fragments are recombined and leads to formation of…

Q: describe the process of dynamic instability of the microtubule.

A: Microtubules are dynamic structures made up of tubulin subunits that play an important role in cell…

Q: In the picture below, the indicated genes are linked, but not syntenic. Gene 14 15 Gene 20

A: A gene is the unit of heredity of a living organism. It can be also defined as a region of genomic…

Q: 4/ Which of the following is true for all proteins? Select the correct response(s): • They are…

A: Proteins are complex macromolecules that are essential for the structure, function, and regulation…

Q: 2. What does NOT happen to the hybrid zone when gene flow is established? O Hybrids cease to form. O…

A: A hybrid zone is a geographic region where two populations of closely related species or subspecies…

Q: Which of the following is a necessary condition for natural selection to occur? The…

A: Natural selection It is defined as a mechanism of evolution in which organisms that are more adapted…

Q: Which of the following is/are true for sickle-cell anemia? I. It results from a point mutation on…

A: Sickle-cell anemia is a genetic disorder that affects the production of hemoglobin in red blood…

Q: sporangiophores are interpreted as modified branches and consist of a stalk and a shield- like…

A: Labeling sporangiophores in Equisetum strobilus is vital for identifying and studying these…

Q: Animals come in many different sizes, for example a large elephant and a small mouse. Using what…

A: Animal kingdom is diverse in many respect. One of the aspect of difference is size. We can see…

Q: Trait: Neurofibromatosis The dominant form is neurofibromatosis, caused by the production of an…

A: A pedigree chart is a diagram that shows the genetic relationships among a group of individuals,…

Q: 5. How might climate change affect the creation of new hybrid zones? 6. What is the difference…

A: Climate change can potentially affect the creation of new hybrid zones by altering the geographic…

Q: Question 30 With your help, the bus arrives at the starting point for photosynthesis. You look at…

A: Photosynthesis is the process by which green plants, algae and some bacteria convert light energy…

Q: The compound (bright-field) microscope is parfocal. It means that: Question 4 options:…

A: The microscope is used to observe microscopic organisms and cellular structure. The compound light…

Q: An individual is sailing off the coast of a remote area and is blown out to sea by a freak storm,…

A: All chemical processes required to maintain cells and an organism in a live state collectively are…

Q: Explain receptor-mediated endocytosis

A: Receptor-mediated endocytosis is a process by which cells internalize specific extracellular…

Q: Discuss a "friendlier way" to present this content to alert people of the risks of hypertension.…

A: Blood pressure is the pressure that is exerted by the blood on the walls of the blood vessels…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

How does polio (poliovirus) get more than one protein from a single mRNA?

Give typing answer with explanation and conclusion

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Explanation

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Where or when does RNA capping at the 5' end of the transcript take place? Give typing answer with explanation and conclusion
For a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the original
How many nucleotides are in the consensus coding sequence (CDS) of the KMT2D transcript? answer in numerical digits only.
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'
Describes a method known as Western blotting that can be used to detect a polypeptide that is translated from a particular mRNA. In this method, a particular polypeptide or protein is detected by an antibody that specifically recognizes a segment of its amino acid sequence. After the antibody binds to the polypeptide within a gel, a secondary antibody (which is labeled) is used to visualize the polypeptide as a dark band.For example, an antibody that recognizes α-galactosidase A couldbe used to specifically detect the amount of α-galactosidase A proteinon a gel. The enzyme α-galactosidase A is defective in individuals with Fabry disease, which shows an X-linked recessive pattern of inheritance. Amy, Nan, and Pete are siblings, and Pete has Fabry disease. Aileen, Jason, and Jerry are brothers and sister, and Jerry has Fabry disease. Amy, Nan, and Pete are not related to Aileen, Jason, and Jerry. Amy, Nan, and Aileen are concerned that they could be carriers of a defective…
draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
You sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that?
You isolate a nuf gene mutant and determine the base sequence of the mutant mRNA: What is the sequence of the first five amino acids in the mutant protein? Mutant amino acid sequence:
Does crude mRNA have density? if so what is the density value ? Thank You
What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA encoding a 100- kDa protein?
Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp d. 100bp
Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.