Q: Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect…
A: The genetic material in most higher organisms is DNA or Deoxyribonucleic Acid. It is a double…
Q: Which group of insects is known as a vector of several diseases to humans? A. Diptera B.…
A: There are a number of diseases which are spread by insect vectors such as malaria, dengue,…
Q: . Give the pathology in : 1 sentence each only g. purpura simplex h. Hereditary hemorrhagic…
A: Pathology can be defined as a branch of science which deals with the study of disease,its cause,…
Q: Which of the following statements are correct about nodule formation by Rhizobium species? P. Nodule…
A: Rhizobium is a nitrogen fixing bacteria. It is showing symbiotic interactions with the legume…
Q: Zoology experiment: The Predator-prey Interactions Between Zebrafish and Daphnia 1. Six 1-L beakers…
A:
Q: QUESTIONS 12 Vertebrates Deuterostomes other Lophotrochozoa other Arthropods Mollusks Radiata…
A: a) Arthropods arthropod phylum Arthropoda any member of the phylum Arthropoda the largest phylum…
Q: You have E. coli growing in HIGH lactose and HIGH glucose. You measure the amounts of protein and…
A: The E.coli is growing in a medium rich in lactose and Glucose both. There are two regulatory…
Q: Gymnosperms have ___________ but no fruits or flowers.
A: Two terms are very common in the plant kingdom - Gymnosperms and Angiosperms. Angiosperms are the…
Q: What are the various techniques in Molecular Biology used for the Isolation, purification, and…
A: Introduction Proteins:- A protein is an extremely complex natural substance made up of amino acid…
Q: E. coli strains diploid for the lac region were constructed by introducing a plasmid carrying the…
A: ANSWER;- I- mutation- repressor is unable to bind to the operator region. If there is no other…
Q: The flower part that makes up the lower (or outermost) whorl of floral leaves is called the…
A: Introduction The reproductive system of angiosperm blooms is unique. The term "flower" is usually…
Q: highlight the statement at the bottom
A: The circulatory system is formed by the heart, the lungs and the blood vessels. The lungs oxygenate…
Q: Water strider is a representative specimen of Hemiptera, which one is NOT their trait? a. The wings…
A: Hemiptera is an order of insects, comprising over 80,000 species within groups such as the cicadas,…
Q: please answer question b also. b. For the Covid-19 pandemic), give any issues, benefits, or…
A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…
Q: 100 g www.L Larvae and pupae per Bt plant T 60 0 h J TOH -- Mosaic, Cry1Ac plant --0-- Mosaic, Cry1C…
A: Bt plant Bt plant is abbreviated for Bacillus Thuringiensis plants. These are transgenic plants…
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: Which refers to the thickening and hardening of the arteries caused by plaque build-up?…
A: The hardening of the arteries occurs when fat, cholesterol, and other substances build up in the…
Q: A researcher was trying to determine whether two molecules (A and B) were corepressors or inducers…
A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…
Q: by Rhizobium species?
A: Answer is P,R and S. Nodulation factors (Nod factors) are chitooligosaccharides produced by…
Q: These describe sea daisies EXCEPT A. Common name is sea daisy B. Usual position in its natural…
A: Sea daisies make up an unusual group of deep-sea taxa belonging to the phylum Echinodermata, with…
Q: What is the effect of linkage and recombination on gamete genotypes?
A: Nucleus is a main controller of the cell which comprises of thread like structure known as…
Q: Which is predatory, uses fours leg, and the males have wings? A. Embiidina B. Dermaptera C.…
A: Insect with four legs and male bearing wings :-
Q: The ilium in the pelvic girdle A. forms the back and sides of the hipbone. B. is the strongest part…
A: Muscles are a type of soft tissue. Your muscles are made up of a lot of elastic fibers. Your body is…
Q: Describe the mycobacterial cell wall and give one reason why it is important in the treatment of the…
A: Introduction:Tuberculosis (TB), which is caused by the intracellular bacteria Mycobacterium…
Q: What happened to the angry clipbird population in the East over the three seasons? Explain why you…
A: Natural selection acts on genetic variation within a population to produce evolution. Natural…
Q: Blank is the enzyme that is used in transcription and blank is the enzyme used in translation
A: Introduction: Protein synthesis is the process of creating proteins from a polypeptide chain of…
Q: Q2: Incomplete reduction of oxygen to water in ETC produces reactive oxygen species (ROS), - Write…
A: Macrophages perform critical roles in the start and resolution of inflammation, primarily by…
Q: Assume that 2.5 ATPs are generated per NADH and 1.5 ATPs per FADH2. How many ATPs are generated from…
A: Beta oxidation is a catabolic pathway in which fatty acids are broken down to acetyl-coA. This…
Q: food, butter or margarine
A: Margarine usually tops butter when it comes to heart health. Margarine is made from vegetable oils,…
Q: 1. Differentiate the platelet aggregometry from platelet closure time as to: (2 sentence each to…
A: We are supposed to answer one question according to our guidelines, please repost other questions…
Q: What determines the maximum rate of Action Potential firing?
A: An action potential is a short-lived event where the electrical membrane potential of a cell rapidly…
Q: When would a population grow in an exponential manner? If limiting factors are not present If it…
A: Populations with unlimited natural resources grow very rapidly, after which population growth…
Q: Lipid absorption involves hydrolysis of dietary fat in the lumen of the intestine followed by the…
A: Lipids are synthesised by the smooth endoplasmic reticulum. For absorption of dietary fats, lipids…
Q: Imagine if mermaids are real. What are their biological and Physical demands (LOCOMOTION, BREATHING,…
A: Mermaids are hypothetical and imaginary organisms specially they are like the females. These are…
Q: 1- "Man is the only real enemy we have. Remove Man from the scene, and the root cause of hunger and…
A: Ecology is the science that deals with the distribution of a number of living species influenced by…
Q: Activation of the fatty acid (converting it to fatty acyl-SCoA) requires the expenditure of 2 ATPs.…
A: There are 3 steps of beta oxidation of saturated fatty acids. This phenomena occurrs in the cytosol,…
Q: Question 2. On the logarithmic scale, an increase from 0.1 to 0.5 moths per plant is the same…
A: As per the given information, Logarithmic increase is from 0.1 to 0.5 moths per plants. The…
Q: In Brinjal eggplants, purple fruit is incompletely dominant to white fruit, with the heterozygote…
A: When a white flowering plant is about to make a cross with a purple flowering plant, the resultant…
Q: Which of the following is not true for a critically endangered species? Expression of deleterious…
A: Answer--- correct option is D
Q: Female cones may be called a(n) _____________________ cone in the Coniferophyta
A: ANSWER;- Female cones may be called a(n) megastrobili cone in the Coniferophyta.
Q: Chemical Defenses: What is the benefit of having an inducible chemical defense, as opposed to a…
A: ANSWER- d is correct Explain;- In the case of the constitutive chemical defense, the constant…
Q: When would a population grow in an exponential manner? If limiting factors are not present If it…
A: Exponential growth may occur in environments where there are few individuals and plentiful…
Q: Examine the graph below and answer the questions provided: (a) At what point of this graph is…
A: The action potential curve in the nerve is given in the image. The graph is present between the…
Q: a) Define the Following: i) Ecology ii) Environment iii) Ecosystem b) State and Explain the…
A: a) Define the Following: i) Ecology ii) Environment iii) Ecosystem b) State and Explain the…
Q: b. Right side 4. Wastes like excess water and salt are excreted through the pores of which organ a.…
A: Kidney is a part of excretory system. It is bean shaped on either side of spine. Disclaimer -…
Q: Rabbit's ears can be either straight (dominant) or floppy (recessive). If a population of rabbits in…
A: Here Hardi Weinberg's principle can be implicated, according to which: p2 + q2 + 2pq =1 p2 ans q2…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: What is the shorthand notation for a fatty acid that contain 20 carbon atoms and double bonds at…
A: Fatty acids are composed of fat in both our body and our meals. The body breaks down lipids into…
Q: Complete the problem below and upload your work here. Partial credit will be considered. In…
A: The chi-square analysis help us to determine the difference between observed and expected data of a…
Q: There are three ways to make ATP. All of them start with the same precursor molecule attached to it.…
A: Carbohydrates are required for supporting infinite life forms on Earth, and carbon dioxide is a…
Step by step
Solved in 3 steps
- Suppose an organism's liver cells have 10 chromosomes. How many chromosomes will its sperm cells have? A. 1 B. 20 C. 5 D. 10What is the purpose of mitosis? a It ensures that new nuclei have an exact copy of DNA. b It ensures the reproduction of mitochondria and chloroplasts. c It guarantees that each daughter cell has half the amount of DNA of parent cells. d It prevents the occurrence of cancer cells.Which statement is NOT true about mitosis? A Mitosis uses a 2n parent cell to form daughter cells containing 1n chromosomes.Mitosis is a process that duplicates and divides the nuclear contents only. B Mitosis produces two daughter cells that contain the same number of chromosomes as the parent cell. C Mitosis uses a 2n parent cell to form daughter cells containing 1n chromosomes. D Mitosis is nuclear division plus cytokinesis.
- Answer the following with respect to Caner.(a) How does a cancerous cell differ from a normal cell?(b) Benign tumor is less dangerous than malignant tumor. Why(c) Describe causes of cancer.(d) mention two methods of treatment of the disease.In eukaryotic cells, which occurs during the prophase of mitosis? A. appearance of the nuclear envelope B. breakup of the nuclear envelope C. replication of DNA D. separation of sister chromatids E. duplication of chromatidspancreas cell has a different function and structure from a brain cell a. because the cells contain different genes. b. because the cells contain different chromosomes. c. because the cells have different replication proteins. d. but the cells have identical DNA.
- 40. First chemicals used to induce cancer? A. Bleach B. Battery acid C. Antifreeze D. Coal tar condensatesB. Meiosis C. Could be either mitosis or meiosis QUESTION 5 What is the role of nonkinetochore microtubules? A. They move the chromosomes to either side of the cell during cell division B. They elongate the cells prior to cell division OC. They aid in DNA replication prior to cell division D. they help to create the cell plate Click Save and Submit to save and submit. Click Save All Answers to save all answers.A twisted ladder that makes up the chromosomes is made of __________
- The functions of the cell part labeled “Z” include — Answer A holding and protecting the chromosomes B providing energy for the cell C capturing sunlight energy D storing waterGive written answer with explanation and conclusion The fluorescent properties of dyes such as SNARF-1 can provide information on the: A) concentration of H+ ions in specific regions of the cell. B) volume of a cell. C) location of specific proteins. D) the amount of RNA in a cell.Short Answer: In the cell cycle is cell division the same in all cell types? Explain
